BL, BL (gene) Prunus persica

Gene Overview
Name BL
Gene Symbol BL
Type gene
Organism Prunus persica
Synonym NAC transcription factor blood
Description NA
Comment related to anthocyanin accumulation in peach flesh
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BLKR822707.1-BL.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
NAC transcription factor bloodBLPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KR822707.1-BL.m1 N/A KR822707.1

Sequence(s):
>KR822707.1-BL.m11323
atgttgggaatggaagacgcagttatgagtgagctgagtggggaagacataaacgagcagggtttgccgccagggtttag
gttccacccaactgacgaggagctcataaccttctatctggcttccaaggtctacaacggctctttctgcggcgtcgaca
ttgctgaggttgacctcaacagatgcgagccctgggagctcccagatatggcaaagatgggggatagagagtggtacttc
ttcagcttgagggacaggaagtacccaacagggttaagaaccaacagagccaccggagctggttactggaaagccactgg
caaggacagacaagtgtacagcgcatccaccggagccttgcttggcatgaagaagactcttgttttctacaaaggccgag
ccccgcgcggccacaagaccaagtgggtcatgcacgagtaccgcctccacggtcacctctcctcctacggcggccacgcc
tgcaaggatgaatgggtgatatgcagaataaatcacaaaacaggggacaaaaaaatcccactacaacttgatcaagttga
agttgaagctgcttcatccaattacaattgcctgcctccattgctggaatctccaacagcagcagcaaaacctacattct
tgcaacaaggacaatgtcctcatcaatctcacaacccaatgcaaatgcaatctcctcatcctcttcctccttttctgttt
cggcaccaagaaaatgacctcaaaagcctcatcaacccagttgtctcccaaccccacctattttcctccttcccaataaa
tgccttgcaaacccaatcctctttttcacccaccaccaccaacagcaacacagcattattaacaaatgataaaaacccat
cacctttgcaatccctcctcttcaaatccctcttctcttcccatgaccaagattgcaataatactattcccaaacagtgc
aagacagagcccaactacttttcccatttccaaacaccagctaataataataataataataataataattgtgacttgaa
ctcgttgaacttgatggaaaagaatcatcatcatcttcatcagccaaacaccccctaccatcaatacagtaatcatccaa
atgatcctttgctttttgattgtttggattatagtgtgttgggcttcccagatgctgctggtactgctacaactgttcat
gagcatgacacgtgtccttcaactgctttcaacagggccgcctttcagaccatgctagaccttcctcccatcaaagtaac
cggagaatcttggcctttggattatatcatggatgctaagtaa
back to top