BOP1, BOP1 (gene) Fragaria vesca subsp. vesca

Gene Overview
Name BOP1
Gene Symbol BOP1
Type gene
Organism Fragaria vesca subsp. vesca
Synonym block of cell proliferation 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BOP1KR092314.1-BOP1.m1Fragaria vesca subsp. vescamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
block of cell proliferation BOPFragaria vesca subsp. vescagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KR092314.1-BOP1.m1 N/A KR092314.1

Sequence(s):
>KR092314.1-BOP1.m12256
atgaaggctaagaagaagagctctcttccagcagactcggcgaaagagcaacagaagaagcaaaaggggaaggggaagat
gaaggtgaagattcccgaggcgaaacaggagcaacagaaaccggaggaggaagttgacactgattctgtttacgattccg
gagctgaagatgagtggactccgtcaagtcttgaggatatgtctggtagtgaaggatctgactcagaggattctccatca
atcagagacacagactcagaagatgaagagagaggttcctccgaaaatgagggtgagctcaaccccagcgtaaatgacgg
tttggacattgatcatggtaatgaggaggaaagtgatagttctggactgcatgaagaagtcgaagaaagtgattcatctg
aagatgaggttgctcctcgaaatacaattggggctgttcccttggagtggtatcgggatgagaaacatattggttatgat
atcacggggaagaagattaaaaagaaggaaagagaagataaattgcaatcctttcttgctagcgctgatgattccaaaaa
ttggcgcaaatttttggatgaatacaatgatgaggaagtagaagtgacaaaggaagatattaaaaccataaatagattac
ttgaaggaaaggcgccacatggggactttgatccatatgcgccttatgttgactggtttaaatgggatgactcaaagcat
ccactgtcaaatgcccctgaacccaagagacgattcattccttcaaaatctgaaagtaaactggtgaagaggttagtatt
agcaattcggaagggtttaattaagcctagaaaggacgaagaagaggaagaagaaaatgtttatcccttgtggggagacg
actctaattcaacagaaaaggacggtagccatttatcttacattccagcgccaaagccaaaattgccggggtatgaggag
tccttcaatcctcctccagaattcatcccgacacaagaagagattgatgcttatcagttaatgtatgaggaagaccgccc
taagtttataccgaaaaggtttacatctatgagaagcatccctgcatatgagaatgctattaaggagtgcttcgaaagat
gtttggatctatacttgtgccccagagttcgtaagaaacgtatcaatattgatcccgaatctctgaagcccaagctacca
agtcgaaaggatctcaagccatatcctgtgaaatgttatctacagtataaaggtcacaaagatagagttacatcagtttc
cacagaagtttcagggcagtggattgcatcaggttcattggatggaactgtgcgtatttgggaggttgaaactggtcgat
gcctcaaactctgggagattggggaagctgtcacacatgtagcttggaatcccaatcctgattattccgtactggctatc
tctgtgggacatgatgtacttattctcaacactggttttgggaatgaagaagtacagcaaaaaactaaagaacttctttc
tgcggaagcacctaccacagcagatgacaaggctaccttcgtgagctggattcaagatgaaacacataacggcacaaggt
taagacattttaagactgtgtcttcagtggaatggcatcgtagaggagactacttttcaactgtggtgccagcaggccaa
tcaaaatcaatttttatgcataggctctctcagaagtctacccagacattttctatcaagttgggcgggcttgcagttac
ttcagttttccatcctgttcgctcccacatcttcatctctacaaagaaaactattcgccaatatgatttggtgaagggaa
agcaaatcagaaagcttgatactggactaaaagaaatctcctccattgcaattcatccttctggtgatcatgtaattgtt
ggtagcagagaaggaaaattttgttggtttgacatggacctttcaactaaaaaaccttacctcattcgccagtggcataa
gaaggacatcaacaatgtggcttaccatcgtttgtacccgttgtttgcaacatgctctgatgattgcactgtacaagttt
ctcatggcatggtttattcagatcttaaccagaaccctcttatagttccactggaaatactccgaggtcatgcaagctca
gatgggagaggtgtaatggattgtaaattccacccaaggcagccctggttattcactgccggagctgactcggtgatcag
actttactgcgattga
back to top