DREB1A, DREB1A (gene) Malus sieversii

Gene Overview
Name DREB1A
Gene Symbol DREB1A
Type gene
Organism Malus sieversii
Synonym DREB1a transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREB1AJQ086361.1-DREB1A.m1Malus sieversiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBMalus sieversiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ086361.1-DREB1A.m1 Chr06:17755035..17755746
JQ086361.1

Sequence(s):
>JQ086361.1-DREB1A.m1711
atgaatacgatcttcagtactcaactctccgattcctccgaaaagcccgaatcgagttccgacgacacaagcatcacggc
tcaaagccagctggcttccttctccgacgaggaggtcattttggcgtccagccggcctaagaagcgagcggggaggagag
ttttcaaggagacgaggcacccagtttacagaggagttaggaggaggaacaacaacaagtgggtgtgcgaaatgagggaa
ccaaacaagaagaagtcgaggatatggctcggaacttatccgacggccgagatggcagctcgggcgcatgacgtggcggc
attggcctttagagggaagcttgcctgcctcaattttgcagactccgcatggcgcctgcctgttccggcatccattgatt
cagtggatatcagacgggccgctgcggaggctgcagagacgttccggccagcggagtttggcggagtgttggaaagcggc
gatgatgagaaggagagcaagaaaatggaggaggagaaggattgtggaggcgtggagggaagtggaatcttgttttactt
ggatgaggaggaaatgttcgacatgccaaggttgctggatagtatggcggaagggcttctgctctctccgcctcactctt
caggtggctacatgaactgggatgacatgggaagcaatgatgacgtcagtctgtggagcttctcaaattga
back to top