LFY1, LFY1 (gene) Amelanchier arborea

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Amelanchier arborea
Synonym LEAFY1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1KT834209.1-LFY1Amelanchier arboreagene
LFY1KT834202.1-LFY1Amelanchier arboreagene
LFY1KT834201.1-LFY1Amelanchier arboreagene
LFY1KT834197.1-LFY1Amelanchier arboreagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1KT834209.1-LFY1.m1Amelanchier arboreamRNA
LFY1KT834202.1-LFY1.m1Amelanchier arboreamRNA
LFY1KT834201.1-LFY1.m1Amelanchier arboreamRNA
LFY1KT834197.1-LFY1.m1Amelanchier arboreamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYAmelanchier arboreagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KT834209.1-LFY1 N/A KT834209.1
gene parsed from NCBI nr database KT834202.1-LFY1 N/A KT834202.1
gene parsed from NCBI nr database KT834201.1-LFY1 N/A KT834201.1
gene parsed from NCBI nr database KT834197.1-LFY1 N/A KT834197.1
mRNA parsed from NCBI nr database KT834209.1-LFY1.m1 N/A KT834209.1
mRNA parsed from NCBI nr database KT834202.1-LFY1.m1 N/A KT834202.1
mRNA parsed from NCBI nr database KT834201.1-LFY1.m1 N/A KT834201.1
mRNA parsed from NCBI nr database KT834197.1-LFY1.m1 N/A KT834197.1

Sequence(s):
>KT834209.1-LFY1827
atggtgacggaaccggggnaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagcagtgccg
tgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggtacggagtttacccatga
tttcatacgctgatttttactgtattaaatacagtaaactcatcttagactcactgatctttgtgggctcatttcctcca
agtacaattataaaatagtaggcagtaataaacttgagtggtcctttgtacacccacgtttgatttctggacgtccatca
aaaaagaaaaagactcttatactcatatataaaattactccaaagactcagtgattgtctaagaaaaacaattgtagggt
tttttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttagatagttcaaccctaa
gcattatctacacactcatttttacctctcacacgccattctcaattcttggccgtcggatcaaatgaattaaaaaagat
cattggaccaaaattaataagaatgtgtcagagataaaaacatatgaaaagcactactaaaaacacttctttcctgttat
gaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacatcgaatttaata
catgtggtctgcaaattttatcaatttaagaatatccgtcaacttttgtgaatttctcgtacaaaatctattaaatttat
cctcttacaagaaatttacattgttga
back to top
>KT834202.1-LFY1962
atggtgacggagccgggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagcagtgccg
tgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggtacggagtttaccgatga
tttcatacgctgatttttactgtattaaatacagtaaactcatcttagactcactgatctttgtgggctcatttcctcca
agtacaattataaaatagtaggcagtaataaacctgagtggtcctttgtacacccacgtttgatttctggacgtccatca
aaaaagaaaaagactcttatactcatatataaaattactccaaagactcagtgattgtctaagaaaaacaattgtagggt
tttttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttagatagttcaaccctaa
gcattatctacacactcatttttacctctcacacgccattctcaattcttggccgtcggatcaaatgaattaaaaaagat
cattggaccaaaattaataagaatgtgtcagagataaaaacatatgaaaagcactactaaaaacacttctttcctgttat
gaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacatcgaatttaata
catgtggtctgcaaattttatcaatttaagaatatccgtcaacttttgtgaatttctcgtacaaaatctattaaatttat
cctcttacaagaaatttacattgttgatgaatattctttgaattggagctactttcttacatcatgagtcaaatttgatg
caatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaattaatttgattcaactatttagtcgactaattaat
tt
back to top
>KT834201.1-LFY1963
atggtgacggagccgggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagcagtgccg
tgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggtacggagtttaccgatga
tttcatacgctgatttttactgtattaaatacagtaaactcatcttagactcactgatctttgtgggctcatttcctcca
agtacaattataaaatagtaggcagtaataaacttgagtggtcctttgtacacccacgtttgatttctggacgtccatca
aaaaagaaaaagactcttatactcatatataaaattactccaaagactcagtgattgtctaagaaaaacaattgtagggt
tttttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttagatagttcaaccctaa
gcattatctacacactcatttttacctctcacacgccattctcaattcttggccgtcggatcaaatgaattaaaaaagat
cattggaccaaaattaataagaatgtgtcagagataaaaacatatgaaaagcactactaaaaacacttctttcctgttat
gaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacatcgaatttaata
catgtggtctgcaaattttatcaatttaagaatatccgtcaacttttgtgaatttctcgtacaaaatctattaaatttat
cctcttacaagaaatttacattgctgatgaatattctttgaattggaactactttcttacatcatgagtcaatttgatgc
aatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaattaatttgattcaactatttagttcgactaatttaa
ttt
back to top
>KT834197.1-LFY1964
atggtgacggagccgggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagcagtgccg
tgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggtacggagtttaccgatga
tttcatacgctgatttttactgtattaaatacagtaaactcatcttagactcactgatctttgtgggctcatttcctcca
agtacaattataaaatagtaggcagtaataaacttgagtggtcctttgtacacccacgtttgatttctggacgtccatca
aaaaagaaaaagactcttatactcatatataaaattactccaaagactcagtgattgtctaaggaaaacaattgtagggt
tttttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcaccagaaacttagatagttcaaccctaa
gcattatctacacactcatttttacctctcacacgccattctcaattcttggccgtcggatcaaatgaattaaaaaagat
cattggaccaaaattaataagaatgtgtcagagataaaaacatatgaaaagcactactaaaaacacttctttcctgttat
gaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacatcgaatttaata
catgtggtctgcaaattttatcaatttaagaatatccgtcaacttttgtgaatttctcgtacaaaatctattaaatttat
cctcttacaagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaaatttgatg
caatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaattaatttgattcaactatttagttcgactaattta
attt
back to top
>KT834209.1-LFY1.m1141
atggtgacggaaccggggnaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagcagtgccg
tgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>KT834202.1-LFY1.m1141
atggtgacggagccgggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagcagtgccg
tgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>KT834201.1-LFY1.m1141
atggtgacggagccgggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagcagtgccg
tgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>KT834197.1-LFY1.m1141
atggtgacggagccgggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagcagtgccg
tgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top