LFY2, LFY2 (gene) Amelanchier arborea

Gene Overview
Name LFY2
Gene Symbol LFY2
Type gene
Organism Amelanchier arborea
Synonym LEAFY2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY2KT834285.1-LFY2Amelanchier arboreagene
LFY2KT834284.1-LFY2Amelanchier arboreagene
LFY2KT834253.1-LFY2Amelanchier arboreagene
LFY2KT834252.1-LFY2Amelanchier arboreagene
LFY2KT834251.1-LFY2Amelanchier arboreagene
LFY2KT834250.1-LFY2Amelanchier arboreagene
LFY2KT834249.1-LFY2Amelanchier arboreagene
LFY2KT834248.1-LFY2Amelanchier arboreagene
LFY2KT834247.1-LFY2Amelanchier arboreagene
LFY2KT834246.1-LFY2Amelanchier arboreagene
LFY2KT834245.1-LFY2Amelanchier arboreagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY2KT834285.1-LFY2.m1Amelanchier arboreamRNA
LFY2KT834284.1-LFY2.m1Amelanchier arboreamRNA
LFY2KT834253.1-LFY2.m1Amelanchier arboreamRNA
LFY2KT834252.1-LFY2.m1Amelanchier arboreamRNA
LFY2KT834251.1-LFY2.m1Amelanchier arboreamRNA
LFY2KT834250.1-LFY2.m1Amelanchier arboreamRNA
LFY2KT834249.1-LFY2.m1Amelanchier arboreamRNA
LFY2KT834248.1-LFY2.m1Amelanchier arboreamRNA
LFY2KT834247.1-LFY2.m1Amelanchier arboreamRNA
LFY2KT834246.1-LFY2.m1Amelanchier arboreamRNA
LFY2KT834245.1-LFY2.m1Amelanchier arboreamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYAmelanchier arboreagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KT834285.1-LFY2 N/A KT834285.1
gene parsed from NCBI nr database KT834284.1-LFY2 N/A KT834284.1
gene parsed from NCBI nr database KT834253.1-LFY2 N/A KT834253.1
gene parsed from NCBI nr database KT834252.1-LFY2 N/A KT834252.1
gene parsed from NCBI nr database KT834251.1-LFY2 N/A KT834251.1
gene parsed from NCBI nr database KT834250.1-LFY2 N/A KT834250.1
gene parsed from NCBI nr database KT834249.1-LFY2 N/A KT834249.1
gene parsed from NCBI nr database KT834248.1-LFY2 N/A KT834248.1
gene parsed from NCBI nr database KT834247.1-LFY2 N/A KT834247.1
gene parsed from NCBI nr database KT834246.1-LFY2 N/A KT834246.1
gene parsed from NCBI nr database KT834245.1-LFY2 N/A KT834245.1
mRNA parsed from NCBI nr database KT834285.1-LFY2.m1 N/A KT834285.1
mRNA parsed from NCBI nr database KT834284.1-LFY2.m1 N/A KT834284.1
mRNA parsed from NCBI nr database KT834253.1-LFY2.m1 N/A KT834253.1
mRNA parsed from NCBI nr database KT834252.1-LFY2.m1 N/A KT834252.1
mRNA parsed from NCBI nr database KT834251.1-LFY2.m1 N/A KT834251.1
mRNA parsed from NCBI nr database KT834250.1-LFY2.m1 N/A KT834250.1
mRNA parsed from NCBI nr database KT834249.1-LFY2.m1 N/A KT834249.1
mRNA parsed from NCBI nr database KT834248.1-LFY2.m1 N/A KT834248.1
mRNA parsed from NCBI nr database KT834247.1-LFY2.m1 N/A KT834247.1
mRNA parsed from NCBI nr database KT834246.1-LFY2.m1 N/A KT834246.1
mRNA parsed from NCBI nr database KT834245.1-LFY2.m1 N/A KT834245.1

Sequence(s):
>KT834285.1-LFY21015
ccgttcatggtgacggaaccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgaagtttta
cccatctcccttttacgtacgatgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaaanntaaaggctagtagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgtagcggttttagttctaggtttgtgctatccacacatcctattttacttct
cacacacttcttgataatttttgtccattgatctttttcaattcattcgatccgacggttgaaaattaaaaaagtgtnng
agaagtaaaatagagtgtgtggatattatatcccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacagaacgatttggtacaaggtattaacgaaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgtttctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtantcaaatacgtgttaagaaaaatgtacgcaatnatantatgaccggatttaa
caaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgc
back to top
>KT834284.1-LFY21017
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgaagtttta
cccatctcccttttacgtacgatgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaaanntaaaggctagtagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgtagcggttttagttctaggtttgtgctatccacacatcctattttacttct
cacacacttcttgataatttttgtccattgatctttttcaattcattcgatccgacggttgaaaattaaaaaagtgtnng
agaagtaaaatagagtgtgtggatattatatcccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacagaacgatttggtacaaggtattaacgaaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcagntctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgtttctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaantgtacgcaatnataatatgaccggatttaa
caaaatgtatantttcgttnantttgcatttgttnactctacacattatatatgcag
back to top
>KT834253.1-LFY21067
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctctcccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgccccaccaaggtacgaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntaaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgcagcggttttagttctagggttgtgctatccacacatcttcttttacttct
cacacactccttgatgatttttgtccattgatctttttcaattcattcgacccgacagttgaaaattaaaaaagtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggtaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatg
aagngtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagcttagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatctgaccggatttaa
caaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggta
tgccaaaaaggcaggggcaagctacat
back to top
>KT834252.1-LFY21067
ccgttcatggtgacggaaccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgtgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntaaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgtagcggttttagttctagggttgtgctatccacacatcttcttttacttct
cacacactccttgatgatttttgtccattgatctttttcaattcattcgatccgacagttgaaaattaaaaaagtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggtaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatg
aagngtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagcttagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatctgaccggatttaa
caaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggta
tgccaaaaaggcaggggcaagctacat
back to top
>KT834251.1-LFY21067
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgtgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntaaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgtagcggttttagttctagggttgtgctatccacacatcttcttttacttct
cacacactccttgatgatttttgtccattgatctttttcaattcattcgatccgacagttgaaaattaaaaaagtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggtaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatg
aagngtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagcttagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatctgaccggatttaa
caaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggtg
tgccaaaaaggcaggggcaagctacat
back to top
>KT834250.1-LFY21067
ccgtttatggtgacggagccggggnaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaaanntaaaggctagtagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgtagcggttttagttctagggttgtgctatccacacatcttattttacttct
cacacacttcttgatgatttttgtccattgatctttttcaattcattcgatccgacggttgaaaattaaaaaagtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggtaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatg
aagngtatcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagcttagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatctgaccggatttaa
caaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggta
tgccaaaaaggcaggggcaagctacat
back to top
>KT834249.1-LFY21067
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaaanntaaaggctagtagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgtagcggttttagttctagggttgtgctatccacacatcttattttacttct
cacacacttcttgatgatttttgtccattgatctttttcaattcattcgatccgacggttgaaaattaaaaaagtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggtaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacagaacgatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttaattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatatgaccggatttaa
caaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggta
tgccaaaaaggcaggggcaagctacat
back to top
>KT834248.1-LFY21067
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaaanntaaaggctagtagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgtagcggttctagttctagggttgtgctatccacacatcttattttacttct
cacacacttcttgatgatttttgtccattgatctttttcaattcattcgatccgacggttgaaaattaaaaaagtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggtaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacagaacgatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttaattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatatgaccggatctaa
caaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggta
tgccaaaaaggcaggggcaagctacat
back to top
>KT834247.1-LFY21067
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgtgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaaanntaaaggctagtagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgtagcggttttagttctagggttgtgctatccacacatcttattttacttct
cacacacttcttgatgatttttgtccattgatctttttcaattcattcgatccgacggttgaaaattaaaaaagtgtnng
agaagtaaantagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggtaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacagaacgatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttaattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatatgaccggatttaa
caaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggta
tgccaaaaaggcaggggcaagctacat
back to top
>KT834246.1-LFY21067
ccgtttatggtgacggaaccgggggaggcggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgacccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaaanntaaaggctagtagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgtagcggttttagttctagggttgtgctatccacacatcttattttacttct
cacacacttctagatgatttttgtccattgatctctttcaattcattcgatccgacggttgaaaattaaaaaagtgtnng
agaagtaaaatagagtgtnnggatattataccccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggtaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacagaacgatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttaattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatatgaccggatttaa
caaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggta
tgccaaaaaggcaggggcaagctacat
back to top
>KT834245.1-LFY21067
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtacgaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaaanntaaaggctagtagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtttgtagcggttttagttctagggttgtgctatccacacatcttattttacttct
cacacacttctagatgatttttgtccattgatctttttcaattcattcgatccgacggttgaaaattaaaaaagtgtnng
agaagtaaaatagagtgtnnggatattataccccttagttctatactttccgcataggcctagtttcgttcatgtattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggtaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacagaacgatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttaattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatatgaccggatttaa
caaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggta
tgccaaaanggcaggggcaagctacat
back to top
>KT834285.1-LFY2.m1147
ccgttcatggtgacggaaccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834284.1-LFY2.m1147
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834253.1-LFY2.m1197
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctctcccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgccccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834252.1-LFY2.m1197
ccgttcatggtgacggaaccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgtgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834251.1-LFY2.m1197
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgtgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtgtgccaaaaaggcaggggcaagctacat
back to top
>KT834250.1-LFY2.m1197
ccgtttatggtgacggagccggggnaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834249.1-LFY2.m1197
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834248.1-LFY2.m1197
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834247.1-LFY2.m1197
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgtgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834246.1-LFY2.m1197
ccgtttatggtgacggaaccgggggaggcggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgacccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834245.1-LFY2.m1197
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcctgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaanggcaggggcaagctacat
back to top