LFY2, LFY2 (gene) Amelanchier bartramiana

Gene Overview
Name LFY2
Gene Symbol LFY2
Type gene
Organism Amelanchier bartramiana
Synonym LEAFY2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY2KT834389.1-LFY2Amelanchier bartramianagene
LFY2KT834385.1-LFY2Amelanchier bartramianagene
LFY2KT834384.1-LFY2Amelanchier bartramianagene
LFY2KT834383.1-LFY2Amelanchier bartramianagene
LFY2KT834336.1-LFY2Amelanchier bartramianagene
LFY2KT834335.1-LFY2Amelanchier bartramianagene
LFY2KT834334.1-LFY2Amelanchier bartramianagene
LFY2KT834333.1-LFY2Amelanchier bartramianagene
LFY2KT834332.1-LFY2Amelanchier bartramianagene
LFY2KT834301.1-LFY2Amelanchier bartramianagene
LFY2KT834300.1-LFY2Amelanchier bartramianagene
LFY2KT834299.1-LFY2Amelanchier bartramianagene
LFY2KT834296.1-LFY2Amelanchier bartramianagene
LFY2KT834295.1-LFY2Amelanchier bartramianagene
LFY2KT834294.1-LFY2Amelanchier bartramianagene
LFY2KT834289.1-LFY2Amelanchier bartramianagene
LFY2KT834288.1-LFY2Amelanchier bartramianagene
LFY2KT834287.1-LFY2Amelanchier bartramianagene
LFY2KT834286.1-LFY2Amelanchier bartramianagene
LFY2KT834260.1-LFY2Amelanchier bartramianagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY2KT834389.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834385.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834384.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834383.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834336.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834335.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834334.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834333.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834332.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834301.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834300.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834299.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834296.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834295.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834294.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834289.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834288.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834287.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834286.1-LFY2.m1Amelanchier bartramianamRNA
LFY2KT834260.1-LFY2.m1Amelanchier bartramianamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYAmelanchier bartramianagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KT834389.1-LFY2 N/A KT834389.1
gene parsed from NCBI nr database KT834385.1-LFY2 N/A KT834385.1
gene parsed from NCBI nr database KT834384.1-LFY2 N/A KT834384.1
gene parsed from NCBI nr database KT834383.1-LFY2 N/A KT834383.1
gene parsed from NCBI nr database KT834336.1-LFY2 N/A KT834336.1
gene parsed from NCBI nr database KT834335.1-LFY2 N/A KT834335.1
gene parsed from NCBI nr database KT834334.1-LFY2 N/A KT834334.1
gene parsed from NCBI nr database KT834333.1-LFY2 N/A KT834333.1
gene parsed from NCBI nr database KT834332.1-LFY2 N/A KT834332.1
gene parsed from NCBI nr database KT834301.1-LFY2 N/A KT834301.1
gene parsed from NCBI nr database KT834300.1-LFY2 N/A KT834300.1
gene parsed from NCBI nr database KT834299.1-LFY2 N/A KT834299.1
gene parsed from NCBI nr database KT834296.1-LFY2 N/A KT834296.1
gene parsed from NCBI nr database KT834295.1-LFY2 N/A KT834295.1
gene parsed from NCBI nr database KT834294.1-LFY2 N/A KT834294.1
gene parsed from NCBI nr database KT834289.1-LFY2 N/A KT834289.1
gene parsed from NCBI nr database KT834288.1-LFY2 N/A KT834288.1
gene parsed from NCBI nr database KT834287.1-LFY2 N/A KT834287.1
gene parsed from NCBI nr database KT834286.1-LFY2 N/A KT834286.1
gene parsed from NCBI nr database KT834260.1-LFY2 N/A KT834260.1
mRNA parsed from NCBI nr database KT834389.1-LFY2.m1 N/A KT834389.1
mRNA parsed from NCBI nr database KT834385.1-LFY2.m1 N/A KT834385.1
mRNA parsed from NCBI nr database KT834384.1-LFY2.m1 N/A KT834384.1
mRNA parsed from NCBI nr database KT834383.1-LFY2.m1 N/A KT834383.1
mRNA parsed from NCBI nr database KT834336.1-LFY2.m1 N/A KT834336.1
mRNA parsed from NCBI nr database KT834335.1-LFY2.m1 N/A KT834335.1
mRNA parsed from NCBI nr database KT834334.1-LFY2.m1 N/A KT834334.1
mRNA parsed from NCBI nr database KT834333.1-LFY2.m1 N/A KT834333.1
mRNA parsed from NCBI nr database KT834332.1-LFY2.m1 N/A KT834332.1
mRNA parsed from NCBI nr database KT834301.1-LFY2.m1 N/A KT834301.1
mRNA parsed from NCBI nr database KT834300.1-LFY2.m1 N/A KT834300.1
mRNA parsed from NCBI nr database KT834299.1-LFY2.m1 N/A KT834299.1
mRNA parsed from NCBI nr database KT834296.1-LFY2.m1 N/A KT834296.1
mRNA parsed from NCBI nr database KT834295.1-LFY2.m1 N/A KT834295.1
mRNA parsed from NCBI nr database KT834294.1-LFY2.m1 N/A KT834294.1
mRNA parsed from NCBI nr database KT834289.1-LFY2.m1 N/A KT834289.1
mRNA parsed from NCBI nr database KT834288.1-LFY2.m1 N/A KT834288.1
mRNA parsed from NCBI nr database KT834287.1-LFY2.m1 N/A KT834287.1
mRNA parsed from NCBI nr database KT834286.1-LFY2.m1 N/A KT834286.1
mRNA parsed from NCBI nr database KT834260.1-LFY2.m1 N/A KT834260.1

Sequence(s):
>KT834389.1-LFY2647
ccgttcatggtgacggagccgggagaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaacctacatcttttaattgaac
tcaacataattattaaattgtcgcgtctatagcggttttagttttaggggtgtgctatctacacactctattttacttct
cacatacttcttgataatttttatccgttgatattcttcaattcatccgatccaatgaccgaaaattaaaaaggtgtgtg
agaagtaaaatgaagtgtgtggatatcacaccccttaattcaatggcaccggtcaaattttgttgaattcttgtatgaag
tgtgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatgaagggt
gtcctcg
back to top
>KT834385.1-LFY2672
ccgttcatggtgacggagccgggggnggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaacctacatcttttaattgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttaggggtgtgctatctacacactctattttacttct
cacatacttcttgataatttttatccgttgatattcttcaattcatccgatccaatgaccgaaaattaaaaaggtgtgtg
agaagtaaaatgaagtgcgtggatatcacaccccttaattcaatggcaccggtcaaattttgttgaattcttgtatgaag
tgtgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggangaagggt
gtcctcgagttggaacaatttgcaatctacat
back to top
>KT834384.1-LFY2773
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggtcttgattacctcttccatctctacgagca
gtgccgtgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgctctgtgggc
tcattttnctgtagtacaatnntaaaggcnnntagtaggcgtaataaatttcaccacaaacctatatcttttaattgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttaggggtgtgctatctacacactctattttacttct
cacatacttcttgataatttttatccgttgatattcttcaattcatccgatccaatgaccgaaaattaaaaaggtgtgtg
agaagtaaaatgaagtgtgtggatatcacaccccttaattcaatggcaccggtcaaattttgttgaattcttgtatgaag
tgtgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatgaagggt
gtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaactacatg
gattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattc
back to top
>KT834383.1-LFY2773
ccgttcatggtgacggaaccgggagaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccctcaccatgttagtcatcgctctgtgggc
tcattttnccgtagtacaatnntaaaggcnnntagtaggcgtaataaatttcaccacaaacctatatcttttaattgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttaggggtgtgctatctacacactctattttacttct
cacatacttcttgataatttttatccgttgatattcttcaattcatccgatccaatgaccgaaaattaaaaaggtgtgtg
agaagtaaaatgaagtgtgtggatatcacatcccttaattcaatggcaccggtcaaattttgttgaattcttgtatgaag
tgtgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatgaagggt
gtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaactacatg
gattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattc
back to top
>KT834336.1-LFY2981
ccgtttatggtgacggaaccgggagaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgctctgtgggc
tcattttnctgtagtacaatnntaaaggcnnntagtaggcgtaataaatttcaccacaaacctatatcttttaattgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttaggggtgtgctatctacacactctattttacttct
cacatacttctcgataatttttatccgttgatattcttcaattcatccgatccaatgaccgaaaattaaaaaggtgtgtg
agaagtaaaatgaagtgtgtggatatcacaccccttaattcaatggcaccggtcaaattttgttgaattcttgtatgaag
tgtgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatgaagggt
gtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaactacatg
gattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgannnnnnn
nnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcanttatantctgaccggatttancaaant
gtataatttcgtttanttngcatttgtttactctacacatnatatatgcaggtgacaaaccaagtgtttaggtatgccaa
aaaggcaggggcaagctacat
back to top
>KT834335.1-LFY2981
ccgttcntggtgacggaaccgggggaggtggcgcgtggcgaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacactgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaacctacatcttttaattgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttaggggtgtgctatctacacactctattttacttct
cacatacttcttgataatttttatccgttgatattcttcaattcatccgatccaatgaccgaaaattaaaaaggtgtgtg
agaagtaaaatgaagtgtgtggatatcacaccccttaattcaatggcaccggtcaaattttgttgaattcttgtatgaag
tgtgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatgaagggt
gtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaactacatg
gattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgannnnnnn
nnnntgattcgattatgatgtantcaaatacgtgttaagaaaaatgtacgcaattataatctgaccggatttaacaaaat
gtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggtatgccaa
aaaggcaggggcaagctacat
back to top
>KT834334.1-LFY2981
ccgttcntggtgacgangccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaacctacgtcttttaattgaac
tcaacataaatattaaattgtcgcgtctatagcggtttnagttttaggggtgtgctatctacacactctattttacttct
cacatacttcttgataatttttatccgttgatattcttcaattcatccgatccaatgaccgaaaattaaaaaggtgtgtg
agaagtaaaatgaagtgtgtggatatcacaccccttaattcaatggcaccggtcaaattttgttgaattcttgtatgaag
tgtgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatgaagggt
gtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaactacatg
gattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgannnnnnn
nnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatctgaccggatttaacaaaat
gtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggtatgccaa
aaaggcaggggcaagctacat
back to top
>KT834333.1-LFY2981
ccgttcatggtgacggaaccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaacctacatcttttaattgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttaggggtgtgctatctacacactctattttacttct
cacatacttcttgataatttttatccgttgatattcttcaattcatccgatccaatgaccgaaaattaaaaaggtgtgtg
agaagtaaaatgaagtgtgtggatatcacaccccttaattcaatggcaccggtcaaattttgttgaattcttgtatgaag
tgtgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatgaagggt
gtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaactacatg
gattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgannnnnnn
nnnntgattcgattatgatgtantcaaatacgtgttaagaaaaatgtacgcaattataatctgaccggatttaacaaaat
gtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggtatgccaa
aaaggcaggggcaagctacat
back to top
>KT834332.1-LFY2981
ccgtttatgntgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaacctacatcttttaattgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttaggggtgtgctatctacacactctattttacttct
cacatacttcttgataatttttatccgttgatattcttcaattcatccgatccaatgaccgaaaattaaaaaggtgtgtg
agaagtaaaatgaagtgtgtggatatcacaccccttaattcaatggcaccggtcaaattttgttgaattcttgtatgaag
tgtgtcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggtattaacggaagttgaggatgaagggt
gtcctcgagttggaacaatttgcaatctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaactacatg
gattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgannnnnnn
nnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatctgaccggatttaacaaaat
gtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggtatgccaa
aaaggcaggggcaagctacat
back to top
>KT834301.1-LFY2773
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcctttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaagtcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatg
back to top
>KT834300.1-LFY2773
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcctttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaagtcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatg
back to top
>KT834299.1-LFY2853
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcggtctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaattcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatagcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaagttaagcgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatt
back to top
>KT834296.1-LFY2958
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcgatctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaagtcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggtattaacggaagttgaggacg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaagttaagcgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtagatagctcagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtantcaaatacgtgtnaggaaaantgtacgcaattataatctgaccggattt
back to top
>KT834295.1-LFY2958
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcggtctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaattcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaagttaagcgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtncaaatttgattctactagtgatttgagtcngan
nnnnnnnnnntgatncgatnatgatgtantcaantacgtgtnangaaaantgtacgcanntataatctgacngattna
back to top
>KT834294.1-LFY2957
ccgtttatggtgacggaaccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcggtctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaattcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaagttaagcgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttangaaaaatgtacgcaattatantctgaccggatt
back to top
>KT834289.1-LFY21017
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcggtctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaattcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccacacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaagttaagcgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatctgaccggatttaa
caaantgtataatttcgtttaatttgcatttgtttactctacacattatatatgcag
back to top
>KT834288.1-LFY21017
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcggtctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaattcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggcattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaagttaagcgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttangaaaaatgtacgcanttatantctgaccggatttan
caaantgtataatttcgtttantttgcattngtttactctacacattatatatgcag
back to top
>KT834287.1-LFY21017
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcggtctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaattcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccacacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaagttaagcgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaantacgtgttaagaaaaatgtacgcanttatantctgaccggatttan
caaantgtatantttcgtttantttgcatttgttnactctacacattatatatgcag
back to top
>KT834286.1-LFY21017
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcggtctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagtttcagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaattcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaattagatgaagttaagcgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttangaaaaatgtacgcanttatantctgaccggatttan
caaantgtataatttcgtttantttgcattngtttactctacacattatatatgcag
back to top
>KT834260.1-LFY21067
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatcagtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtaccaagtttta
cccatctcccttttacgtacgctgatttctactgtagaaaataacagtaccttcaccatgttagtcatcggtctgtgggc
tcattttnctgtagtacaatnntgaaggcnnntagtaggcgtaataaatttcaccacaaatctatatcttttaatcgaac
tcaacataaatattaaattgtcgcgtctatagcggttttagttttagggttgtgctatccacacattctattttacttct
cacacactccttaataatttttgtcaattgatctttttcaattcattcgatccgacggtcgaaaattaaaaaggtgtnng
agaagtaaaatagagtgtgtggatattataccccttagttctatactttccgcataggcctagtttcgttcatgcattgc
aagtagcatcaacattggtccatacaattcgcaaattactgtaattcaatggcaccggtcaaattttgttgaattcttgt
atgaagtctgtcaaatttacccttttgtngtaccgtgcacataaagatttggtacaaggtattaacggaagttgaggatg
aagggtgtcctcgagttggaacaatttgcaatctacatggactaaatnagatgaagttaagcgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaaatttgattctactagtgatttgagtccgan
nnnnnnnnnntgattcgattatgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatctgaccggatttaa
cgaaatgtataatttcgtttaatttgcatttgtttactctacacattatatatgcaggtgacaaaccaagtgtttaggta
tgccaaaaaggcaggggcaagctacat
back to top
>KT834389.1-LFY2.m1147
ccgttcatggtgacggagccgggagaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834385.1-LFY2.m1147
ccgttcatggtgacggagccgggggnggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834384.1-LFY2.m1147
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggtcttgattacctcttccatctctacgagca
gtgccgtgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834383.1-LFY2.m1147
ccgttcatggtgacggaaccgggagaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834336.1-LFY2.m1197
ccgtttatggtgacggaaccgggagaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834335.1-LFY2.m1197
ccgttcntggtgacggaaccgggggaggtggcgcgtggcgaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacactgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834334.1-LFY2.m1197
ccgttcntggtgacgangccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834333.1-LFY2.m1197
ccgttcatggtgacggaaccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834332.1-LFY2.m1197
ccgtttatgntgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top
>KT834301.1-LFY2.m1147
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834300.1-LFY2.m1147
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834299.1-LFY2.m1147
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834296.1-LFY2.m1147
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834295.1-LFY2.m1147
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834294.1-LFY2.m1147
ccgtttatggtgacggaaccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834289.1-LFY2.m1147
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834288.1-LFY2.m1147
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834287.1-LFY2.m1147
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834286.1-LFY2.m1147
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctgtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaag
back to top
>KT834260.1-LFY2.m1197
ccgtttatggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatcagtacgagca
atgccgcgatttcttgatccaggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggtgacaaaccaag
tgtttaggtatgccaaaaaggcaggggcaagctacat
back to top