MYB20, MYB20 (gene) Prunus persica

Gene Overview
Name MYB20
Gene Symbol MYB20
Type gene
Organism Prunus persica
Synonym R2R3-MYB transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MYB20KT159236.1-MYB20.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
myb transcription factorMYBPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KT159236.1-MYB20.m1 N/A KT159236.1

Sequence(s):
>KT159236.1-MYB20.m1951
atggggaggtcaccttgctgtgagaaagctcacaccaacaaaggcgcttggaccaaagaagaagaccagcgcctcatcga
ttacatccgcgtccatggcgaaggctgctggcgctccctccccaaagccgctgggttgcttaggtgcggcaagagctgta
ggctgagatggataaactaccttcgccctgacctcaagcgtggaaatttcacagaagaagaagatgagctcatcatcaag
ctccatagcttacttggaaacaagtggtcattgattgcggggcgattgccgggaagaaccgacaacgaaataaaaaacta
ctggaatacacacatcaagcggaagctcatcagccgtggcctcgaccctcaaacccaccgtccgctcaacgacaccacaa
ccgcagcggcggcagcggccgccacgacacctgcttctcgcttagatttcagaaacatttctccgccatccgccgtcgtc
gataaaaccaccaacaaaaattccatattgcatcacaaaaccatcaacaaaacctcctcgaacaacaacaaccacaacag
caatatcgtattgttcaagcccaagatggaagaggacaacatagaagaggccagcagtgggaccaccacagaggaagacc
aacaacaacaacaacaacagcaacagcagaaattgcaagatcattatatgtacaagtgtagtgacctcaacttggatctt
tcaattgggctggagcccttccagtccgagccaactcgggcttcgtcggggaactcggccgagtcaagactgcagcagaa
taattaccaggtttttgggacagtgcataaggcgggggtgactcaggcggtgtgtttgtgttgtcaggttggattccaga
gcagcgacgcttgtaggaattgtcagtgcacaaatgggttctacagatttcacagacctttgaattcatag
back to top