RPL3, RPL3 (gene) Dasiphora fruticosa subsp. floribunda

Gene Overview
Name RPL3
Gene Symbol RPL3
Type gene
Organism Dasiphora fruticosa subsp. floribunda
Synonym ribosomal protein S3
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
RPL3KC825072.1-RPL3Dasiphora fruticosa subsp. floribundagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
RPL3KC825072.1-RPL3.m1Dasiphora fruticosa subsp. floribundamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
ribosomal proteinRPLDasiphora fruticosa subsp. floribundagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC825072.1-RPL3 N/A KC825072.1
mRNA parsed from NCBI nr database KC825072.1-RPL3.m1 N/A KC825072.1

Sequence(s):
>KC825072.1-RPL31583
tggtaaatcantgtatcaagatgtcaatctgagatcttatttcggttcgatacgtccacctacgagactgacctttggct
ttcgtctcggtacgtgtattattctacattttccaaaaagagcattcattcatttctttcttccccgtcgaccacgacga
ctgaaacgacgcgaaaaatcnagacccggaaaggagtggtgggcttttgggaaagtcgggccgatcaggtgtcttcattc
aagcgacgatacagaagaagaacgaaacgaagtgagaggccgggnggcagngaaaagagtcgagtcgatcaggctcgacg
accgggagaagcaaaacgaaattcggatttggccgaaaaagaagcaacgctatggataccatgaccgatcaccatcgata
aagaagaatctttctaaatcacttcgggtcagcngggccntcaagcatccnnnnnnnnnnnnnnnnnnnnnnnnnnnagc
gttcctgatagaaaatgacgactccttcagaaaaacnaagttattnaagttntttttnccannnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngaattattcagtcatgcaatacttattgaatacaaag
aaccaaattaatttagaccccgtcgtagttttcaatcatttcgtggcaccgagcgtgtctgaaccatctacgatgggggg
agcgaatgcacagggaagaagcttagataagagaatacgttctcgcatcgctttttttgtagaaagctcgaccagcgaga
aaaagtntttgnccgaagccaaaaagaggttgacccacttcannnnnnnagcgaatgatcttcgcttcgcgggaacaaca
aaaaccaccatctcgctctttccttttttcggtgctacctttttctttccaagggatggggttgggatgtataataacct
tttttttgaagatgcccgggaacaactcctaggtcnnnnnnnnnnnnnnnnnnnnnnnnncatgggtaaggatanngtaa
tngaattgatagagaaattcatagacctaggtaggataggagaattgataaagggaatagagatgatgatagagatcata
ctgagaaacagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatag
aacaaacactaatatcttaattgagtcggtcaagataaaatctgtttatcaaagtgcttctccgattgctcaagacatct
cttttcaactgagaaacaaaacaagatcatttcgttccatttttagtaaaanngtgaaggatattnnnnnnnnaatgaaa
annnnnnnnnnnnngatccgtatatgttgttcaggtcgattaaaaggcgcagaaatagctagaactgaatgcggaaagta
tggaaaaacatctcgtaatgtatttaaccagaaaatagattatgctcctgcggaagtatctactcgttatggaatcttag
gtgtcaaagtgtggatttcatatagtaaaaaaaagggacgtgctatatccgaaacgtacgaaa
back to top
>KC825072.1-RPL3.m11583
tggtaaatcantgtatcaagatgtcaatctgagatcttatttcggttcgatacgtccacctacgagactgacctttggct
ttcgtctcggtacgtgtattattctacattttccaaaaagagcattcattcatttctttcttccccgtcgaccacgacga
ctgaaacgacgcgaaaaatcnagacccggaaaggagtggtgggcttttgggaaagtcgggccgatcaggtgtcttcattc
aagcgacgatacagaagaagaacgaaacgaagtgagaggccgggnggcagngaaaagagtcgagtcgatcaggctcgacg
accgggagaagcaaaacgaaattcggatttggccgaaaaagaagcaacgctatggataccatgaccgatcaccatcgata
aagaagaatctttctaaatcacttcgggtcagcngggccntcaagcatccnnnnnnnnnnnnnnnnnnnnnnnnnnnagc
gttcctgatagaaaatgacgactccttcagaaaaacnaagttattnaagttntttttnccannnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngaattattcagtcatgcaatacttattgaatacaaag
aaccaaattaatttagaccccgtcgtagttttcaatcatttcgtggcaccgagcgtgtctgaaccatctacgatgggggg
agcgaatgcacagggaagaagcttagataagagaatacgttctcgcatcgctttttttgtagaaagctcgaccagcgaga
aaaagtntttgnccgaagccaaaaagaggttgacccacttcannnnnnnagcgaatgatcttcgcttcgcgggaacaaca
aaaaccaccatctcgctctttccttttttcggtgctacctttttctttccaagggatggggttgggatgtataataacct
tttttttgaagatgcccgggaacaactcctaggtcnnnnnnnnnnnnnnnnnnnnnnnnncatgggtaaggatanngtaa
tngaattgatagagaaattcatagacctaggtaggataggagaattgataaagggaatagagatgatgatagagatcata
ctgagaaacagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatag
aacaaacactaatatcttaattgagtcggtcaagataaaatctgtttatcaaagtgcttctccgattgctcaagacatct
cttttcaactgagaaacaaaacaagatcatttcgttccatttttagtaaaanngtgaaggatattnnnnnnnnaatgaaa
annnnnnnnnnnnngatccgtatatgttgttcaggtcgattaaaaggcgcagaaatagctagaactgaatgcggaaagta
tggaaaaacatctcgtaatgtatttaaccagaaaatagattatgctcctgcggaagtatctactcgttatggaatcttag
gtgtcaaagtgtggatttcatatagtaaaaaaaagggacgtgctatatccgaaacgtacgaaa
back to top