RPL3, RPL3 (gene) Fragaria vesca subsp. vesca

Gene Overview
Name RPL3
Gene Symbol RPL3
Type gene
Organism Fragaria vesca subsp. vesca
Synonym ribosomal protein S3
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
RPL3KC825078.1-RPL3Fragaria vesca subsp. vescagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
RPL3KC825078.1-RPL3.m1Fragaria vesca subsp. vescamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
ribosomal proteinRPLFragaria vesca subsp. vescagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC825078.1-RPL3 N/A KC825078.1
mRNA parsed from NCBI nr database KC825078.1-RPL3.m1 N/A KC825078.1

Sequence(s):
>KC825078.1-RPL31585
tggtaaatcagtgtatcaagatgtcaatctgagatcttatttcggttcgatacgtccacctacgagactgacctttggct
ttcgtctcggtacgtgtattattctacattttccaaaaagagcattcattcatttctttcttccccgtcgaccacgacga
ctgaaacgacgcgaaaaatccagacccggaaaggagtggtgggcttttgggaaagtcgggccgatcaggtgtcttcattc
aagcgacgatacagaagaagaacgaaacgaagtgagaggccggggggcagggaaaagagtcgagtcgatcaggctcgacg
accgggagaagcaaaacgaaattcggatttggccgaaaaagaagcaacgctatggataccatgaccgatcaccatcgata
aagaagaatctttctaaatcacttcgggtcagcagggccttcaagcatccgaaatacgccggggttgtaaatgacatagc
gttcctgatagaaaatgacgactccttcagaaaaacaaagttattaaagttctttttgccaaagaaatccggccccacga
gtcatctacttaaaaggaccctccccgcagtgcgcccctctttgaattattcggtcatgcaatacttattgaatacaaag
aaccaaatgaatttagaccccgtcgtagttctcaatcatttcgtggcaccgagcgtgtctgaaccatctacgatgggggg
agcgaatgcacagggaagaagcttagataagagaatacgttctcgcatcgctttttttgtagaaagctcgaccagcgaga
aaaagtctttggccgaagccaaaaagaggttgacccacttcattcgccaagcgaatgatcttcgcttcgcgggaacaaca
aaaaccaccatctcgctctttccttttttcggtgctacctttttctttccaagggatggggttgggatgtataataacct
tttttttgaagatgcccgggaacaactcctaggtcaattaagaatcaaatgttggaacctcatgggtaaggataaggtaa
tggaattgatagagaaattcatagacctaggtaggataggagaattgataaagggaatagagatgatgatagagatcata
ctgagaaacagaagaattccgtacgggtacaactcttatttgaacgaagtgaaaaaaatacgatctttgttgtctaatag
aacaaacactaatatcttaattgagtcggtcaagataaaatctgtttatcaaagtgcttctacgattgctcaagacatct
cttttcaactgagaaacaaaacaagatcatttcgttccatttttagtaaaatagtgaaggatattccattagtaatgaaa
aaaggggttgaggggatccgtatatgttgttcaggtcgattaaaaggcgcagaaatagctagaactgaatgcggaaagta
tggaaaaacatctcgtaatgtatttaaccagaaaatagattatgctcctgcggaagtatctactcgttatggaatcttag
gtgtcaaagtgtggatttcatatagtaaaaaaaagggacgtgctatatccgaaacgtacgaaatt
back to top
>KC825078.1-RPL3.m11585
tggtaaatcagtgtatcaagatgtcaatctgagatcttatttcggttcgatacgtccacctacgagactgacctttggct
ttcgtctcggtacgtgtattattctacattttccaaaaagagcattcattcatttctttcttccccgtcgaccacgacga
ctgaaacgacgcgaaaaatccagacccggaaaggagtggtgggcttttgggaaagtcgggccgatcaggtgtcttcattc
aagcgacgatacagaagaagaacgaaacgaagtgagaggccggggggcagggaaaagagtcgagtcgatcaggctcgacg
accgggagaagcaaaacgaaattcggatttggccgaaaaagaagcaacgctatggataccatgaccgatcaccatcgata
aagaagaatctttctaaatcacttcgggtcagcagggccttcaagcatccgaaatacgccggggttgtaaatgacatagc
gttcctgatagaaaatgacgactccttcagaaaaacaaagttattaaagttctttttgccaaagaaatccggccccacga
gtcatctacttaaaaggaccctccccgcagtgcgcccctctttgaattattcggtcatgcaatacttattgaatacaaag
aaccaaatgaatttagaccccgtcgtagttctcaatcatttcgtggcaccgagcgtgtctgaaccatctacgatgggggg
agcgaatgcacagggaagaagcttagataagagaatacgttctcgcatcgctttttttgtagaaagctcgaccagcgaga
aaaagtctttggccgaagccaaaaagaggttgacccacttcattcgccaagcgaatgatcttcgcttcgcgggaacaaca
aaaaccaccatctcgctctttccttttttcggtgctacctttttctttccaagggatggggttgggatgtataataacct
tttttttgaagatgcccgggaacaactcctaggtcaattaagaatcaaatgttggaacctcatgggtaaggataaggtaa
tggaattgatagagaaattcatagacctaggtaggataggagaattgataaagggaatagagatgatgatagagatcata
ctgagaaacagaagaattccgtacgggtacaactcttatttgaacgaagtgaaaaaaatacgatctttgttgtctaatag
aacaaacactaatatcttaattgagtcggtcaagataaaatctgtttatcaaagtgcttctacgattgctcaagacatct
cttttcaactgagaaacaaaacaagatcatttcgttccatttttagtaaaatagtgaaggatattccattagtaatgaaa
aaaggggttgaggggatccgtatatgttgttcaggtcgattaaaaggcgcagaaatagctagaactgaatgcggaaagta
tggaaaaacatctcgtaatgtatttaaccagaaaatagattatgctcctgcggaagtatctactcgttatggaatcttag
gtgtcaaagtgtggatttcatatagtaaaaaaaagggacgtgctatatccgaaacgtacgaaatt
back to top