SFB12, SFB12 (gene) Eriobotrya japonica

Gene Overview
Name SFB12
Gene Symbol SFB12
Type gene
Organism Eriobotrya japonica
Synonym S-haplotype-specific F-box protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB12KR149308.1-SFB12Eriobotrya japonicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB12KR149308.1-SFB12.m1Eriobotrya japonicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBEriobotrya japonicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KR149308.1-SFB12 N/A KR149308.1
mRNA parsed from NCBI nr database KR149308.1-SFB12.m1 N/A KR149308.1

Sequence(s):
>KR149308.1-SFB121135
atgtctcaggtgtgtgaaagtgaaactcctgaagatagaacggtcgaaatcttgtccaggttaccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagttatatggtccgtgattaatctttccattgatggcgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaaaggatgaccatcatgaagtagagattcacggttattgcgacgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaatttggattggaaacgacccttaaaggtctgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactg
ctgaagtatacaccatggccgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtgtttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagagttgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccatcacttattattgcactagttacgaggagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaacagctggaccttttaaagacatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattacctccgatggaagagctgcctcttataattcttgtaccgaaaatttcaagtatc
ttcatattcctgcga
back to top
>KR149308.1-SFB12.m11135
atgtctcaggtgtgtgaaagtgaaactcctgaagatagaacggtcgaaatcttgtccaggttaccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagttatatggtccgtgattaatctttccattgatggcgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaaaggatgaccatcatgaagtagagattcacggttattgcgacgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaatttggattggaaacgacccttaaaggtctgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactg
ctgaagtatacaccatggccgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtgtttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagagttgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccatcacttattattgcactagttacgaggagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaacagctggaccttttaaagacatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattacctccgatggaagagctgcctcttataattcttgtaccgaaaatttcaagtatc
ttcatattcctgcga
back to top