SVP1, SVP1 (gene) Prunus mume

Gene Overview
Name SVP1
Gene Symbol SVP1
Type gene
Organism Prunus mume
Synonym SVP-like protein 1
Description NA
Comment PmSVP-like1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SVP1KT803845.1-SVP1.m1Prunus mumemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Short vegetative phase SVPPrunus mumegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KT803845.1-SVP1.m1 N/A KT803845.1

Sequence(s):
>KT803845.1-SVP1.m1687
atggcgagggagaagattcagatcaagaagatcgacaacgccacggcgaggcaggtgaccttttccaagcggaggagagg
gcttttcaagaaggctcaggagctctccgttctctgtgatgcagatattgctcttatcatcttttcttccactggaaaac
tctttgaatacgccagctccagcacgaaggaaattctagaacgtcacaacttgcacgcaaagaatctctcgaaaatagaa
caaccatctcttgagttacagctagtggagaacagcaactactctgcgttgagcaaggaaattacagcacaaagtcaaca
acttaggcagataaggggagaagaaatccaaggattaaatttggaagaattgcagcaactggagaagtctcttgaagctg
gattgggccgcgtaatagagaaaaagggtgaaaagattatgaaagagatcagcgatctcgaaagcaatgcgatgcgattg
gttgaagagaatgaacggctgagacagcaagtgctggagaaacataatagccagaggccggttcgggccgattcagaaaa
catggttatggaggagggtcagtcatcagagtctgtcaccaccaacctctgcaactctaacagcgctccgcaagactatg
agagctcagatacatctctcaaattggggttaccttactctggttaa
back to top