SVP, SVP (gene) Prunus pseudocerasus

Gene Overview
Name SVP
Gene Symbol SVP
Type gene
Organism Prunus pseudocerasus
Synonym SVP-like protein
Description NA
Comment MADS-box
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SVPKP347548.1-SVP.m1Prunus pseudocerasusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Short vegetative phase SVPPrunus pseudocerasusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KP347548.1-SVP.m1 N/A KP347548.1

Sequence(s):
>KP347548.1-SVP.m1660
atgacgaggaggaaaatccagatcaagaagatcgacaacacaacggccaggcaggtgacgttttcgaagaggaggagagg
gcttttcaagaaagcccaggagctctctactctctgtgatgctgagattgctcttgtagtcttctccgctactgggaagc
tctttgaatacaccagctccagcgtgcaacaagtaattgaaaggcatggcctgctttcttccacttttgacaagttgaat
caaccatctcttgatctgcagcttgagagcagtacttccgccgcattgagcaaggaaattgcggagaatacacatgagct
aaggaagctaatgggagaagaactccaagaactaaacatgaaagagttgcaggaactagagaaactgctcggatcaggat
tgaagcgtgttagagatgcaaagggtgaaattgttctgaaggagatcacctctcttaagtggaagggatccctactgatg
caagaaaacaagcaattgaagcagatggcaaaccaacagatccaaacacttgaacttgaacttgaacaaggccaatcctc
cgagccaataggcgatttcatccattcagatccttctcaagaccacgacagctctggcacttctctcaagttggggttag
cttttcctaacgggatatga
back to top