SVP, SVP (gene) Pyrus pyrifolia

Gene Overview
Name SVP
Gene Symbol SVP
Type gene
Organism Pyrus pyrifolia
Synonym SVP-like MADS-box protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SVPKP164029.1-SVP.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Short vegetative phase SVPPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KP164029.1-SVP.m1 N/A KP164029.1

Sequence(s):
>KP164029.1-SVP.m1684
atggcgagggagaagattcagatcaagaagatcgacaacgcgacagcgaggcaggtgacactttccaagaggagaagagg
ccttttcaagaaggctgaggagctctccgttctctgtgatgccgatattgctcttatcatcttttcttccaccggaaagc
tctttgaatacgccagcgctagtatggaggaaattctagaaaggcacaacttgcattcaaagaatctcgacaaactagaa
caaccatctcttgagttacagctagtggagaacagcaactactccaggttgagcaaggaaattgcagcaaaaagtcatca
acttaggcagatgagaggagaagaaattcaaggactaagtttggaagaactgcaacaattggagaagctccttgaagctg
gcttgggtggcgtagtagagaaaaagagtgaaaagattatgaaagagatcaacgatcttcaaagaaatgctatgcaattg
acggaagagaatgaacgattaagacagcaagtggtggagaaatctaatggccggaggcttgttcatgtcgattcagaaaa
cctgattacggaggagggtcagtcatcagagtctgtcaccaatctctgtaaatctaacagcggtcctcaagactatgaca
gctcagttacatctctaaaattggggctgccctactctggttga
back to top