SWEET17, SWEET17 (gene) Prunus persica

Gene Overview
Name SWEET17
Gene Symbol SWEET17
Type gene
Organism Prunus persica
Synonym bidirectional sugar transporter SWEET17
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SWEET17KT893423.1-SWEET17.m1Prunus persicamRNA
SWEET17KT893422.1-SWEET17.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Sugars will be eventually exported transporter SWEETPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KT893423.1-SWEET17.m1 N/A KT893423.1
mRNA parsed from NCBI nr database KT893422.1-SWEET17.m1 N/A KT893422.1

Sequence(s):
>KT893423.1-SWEET17.m1756
atggaaggattaattatatttattggggtcataggcaacatcatctcagtgctaatgttccttgctcctgtcggaacgtt
ttggagaattgtaaagcaccgatcgacggaggacttcgagagtctgccttatgtttgcacattcctcaactccttcttgt
ggacttattatggaattataaggcccgccggaggattacttgtggccactgtcaatggttttggtgtcgttgttgagatt
atctaccttattttgtttctagtatatgccccagcaaagatgagggcaaagacggccatcttgattggaaccttggatgt
gggttttctagtagctgccattttagctacctggctggcattgcagggagagacacgtattgatgcactagggttcattt
gtgcaggcttaaacatcatcatgtacggctcgccgctagttgccatgaaaacagtgataacaactaagagtgtggagtac
atgccattcttcctctcatttttctttttcctcaacggaggggtgtggactctctatgcttggctcatacgagatgtttt
ccttggggtaccaaacgggattgggtttcttcttggaacaacgcagctagtgctatatgcgatttacagaaatgccaaac
cagccgataatatttcaagtgggctgctggaagaaggaaggcaacatgaacctcttatctcaccttcttctgctactcca
tcacaaaaaaatggagaaatattggagaccacttaa
back to top
>KT893422.1-SWEET17.m1712
atggaaggattaattatatttattggggtcataggcaacatcatctcagtgctaatgttccttgctcctgtcggaacgtt
ttggagaattgtaaagcaccgatcgacggaggacttcgagagtctgccttatgtttgcacattcctcaactccttcttgt
ggacttattatggaattataaggcccgccggaggattacttgtggccactgtcaatggttttggtgtcgttgttgagatt
atctaccttattttgtttctagtatatgccccagcaaagatgagggcaaagacggccatcttgattggaaccttggatgt
gggttttctagtagctgccattttagctacctggctggcattgcagggagagacacgtattgatgcactagggttcattt
gtgcaggcttaaacatcatcatgtacggctcgccgctagttgccatgaaaacagtgataacaactaagagtgtggagtac
atgccattcttcctctcatttttctttttcctcaacggaggggtgtggactctctatgcttggctcatacgagatgtttt
ccttggggtaccaaacgggattgggtttcttcttggaacaacgcagctagtgctatatgcgatttacagaaatgccaaac
cagccgataatatttcaagtgggctgctggaagaaggaaggcaacatgaacctcttatctcaccttcttctg
back to top