GAPDH, KR105796.1-GAPDH (gene) Rosa prattii

Gene Overview
Unique NameKR105796.1-GAPDH
OrganismRosa prattii ()
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa prattiigene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHKR105796.1-GAPDH.m1Rosa prattiimRNA

Cross References
External references for this gene
Feature NameTypeLocationAnalysis
KR105796 region KR105796:1..652+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

gene sequence

>KR105796.1-GAPDH ID=KR105796.1-GAPDH|Name=GAPDH|organism=Rosa prattii|type=gene|length=652bp
back to top

gene from alignment at KR105796:1..652+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KR105796.1-GAPDH ID=KR105796.1-GAPDH|Name=GAPDH|organism=Rosa prattii|type=gene|length=652bp|location=Sequence derived from alignment at KR105796:1..652+ (Rosa prattii)
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaa gatactagatttgaaaccaactaaagttgtctgtgtatttgcaattcagc cacccagaagactgttgatggaccatcagcaaaggactggagaggtggac gtgctgcctcattcaacatcattcccagcagcactggagctgccaaggta ttttcaatattctttgtgccactgcttcagtattgttgatacacttttaa gttacatgtcagtgatacttcatctttaacagctttattaatccttgatt ttggaacatctttaggctgtcggaaaggttctgcctgctctcaatggcaa gttgaccggaatggccttccgtgtacccaccgttgatgtttcagttgttg acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggct gctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaag gtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatct ttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatct tgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaac ag
back to top