GAPDH, KR105795.1-GAPDH (gene) Rosa prattii

Gene Overview
NameGAPDH
Unique NameKR105795.1-GAPDH
Typegene
OrganismRosa prattii ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa prattiigene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHKR105795.1-GAPDH.m1Rosa prattiimRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreKR105795.1
Alignments
Feature NameTypeLocationAnalysis
KR105795 region KR105795:1..652+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>KR105795.1-GAPDH ID=KR105795.1-GAPDH|Name=GAPDH|organism=Rosa prattii|type=gene|length=652bp
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaa
gatactagatttgaaaccaactaaagttgtctgtgtatttgcaaatcagc
cacccagaagactgttgatggaccatcagcaaaggactggagaggtggac
gtgctgcctcattcaacatcattcccagcagcactggagctgccaaggta
ttttcaatattctttgtgccactgcttcagtattgttgatacacttttaa
gttacatgtcagtgatacttcatctttaacagctttattaatccttgatt
ttggaacatctttaggctgtcggaaaggttctgcctgctctcaatggcaa
gttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggct
gctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaag
gtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatct
ttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatct
tgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaac
ag
back to top

gene from alignment at KR105795:1..652+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KR105795.1-GAPDH ID=KR105795.1-GAPDH|Name=GAPDH|organism=Rosa prattii|type=gene|length=652bp|location=Sequence derived from alignment at KR105795:1..652+ (Rosa prattii)
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaa gatactagatttgaaaccaactaaagttgtctgtgtatttgcaaatcagc cacccagaagactgttgatggaccatcagcaaaggactggagaggtggac gtgctgcctcattcaacatcattcccagcagcactggagctgccaaggta ttttcaatattctttgtgccactgcttcagtattgttgatacacttttaa gttacatgtcagtgatacttcatctttaacagctttattaatccttgatt ttggaacatctttaggctgtcggaaaggttctgcctgctctcaatggcaa gttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggct gctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaag gtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatct ttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatct tgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaac ag
back to top