LFY2, KT834251.1-LFY2 (gene) Amelanchier arborea

Gene Overview
NameLFY2
Unique NameKT834251.1-LFY2
Typegene
OrganismAmelanchier arborea ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY2LFY2Amelanchier arboreagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFY2KT834251.1-LFY2.m1Amelanchier arboreamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreKT834251.1
Alignments
Feature NameTypeLocationAnalysis
KT834251 region KT834251:1..1067+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>KT834251.1-LFY2 ID=KT834251.1-LFY2|Name=LFY2|organism=Amelanchier arborea|type=gene|length=1067bp
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacgg
cctcgattacctcttccatctgtacgagcaatgccgtgatttcttgatcc
aggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggta
cgaagttttacccatctcccttttacgtacgctgatttctactgtagaaa
ataacagtaccttcaccatgttagtcatcgatctgtgggctcattttnct
gtagtacaatnntaaaggcnnntagtaggcgtaataaatttcaccacaaa
tctatatcttttaatcgaactcaacataaatattaaattgtcgcgtttgt
agcggttttagttctagggttgtgctatccacacatcttcttttacttct
cacacactccttgatgatttttgtccattgatctttttcaattcattcga
tccgacagttgaaaattaaaaaagtgtnngagaagtaaaatagagtgtgt
ggatattataccccttagttctatactttccgcataggcctagtttcgtt
catgtattgcaagtagcatcaacattggtccatacaattcgcaaattact
gtaattcaatggtaccggtcaaattttgttgaattcttgtatgaagtctg
tcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggt
attaacggaagttgaggatgaagngtgtcctcgagttggaacaatttgca
atctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac
tacatggattaaaaacgtgtttcgggtaaatagcttagtatttagtccaa
atttgattctactagtgatttgagtccgannnnnnnnnnntgattcgatt
atgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatctga
ccggatttaacaaaatgtataatttcgtttaatttgcatttgtttactct
acacattatatatgcaggtgacaaaccaagtgtttaggtgtgccaaaaag
gcaggggcaagctacat
back to top

gene from alignment at KT834251:1..1067+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KT834251.1-LFY2 ID=KT834251.1-LFY2|Name=LFY2|organism=Amelanchier arborea|type=gene|length=1067bp|location=Sequence derived from alignment at KT834251:1..1067+ (Amelanchier arborea)
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacgg cctcgattacctcttccatctgtacgagcaatgccgtgatttcttgatcc aggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggta cgaagttttacccatctcccttttacgtacgctgatttctactgtagaaa ataacagtaccttcaccatgttagtcatcgatctgtgggctcattttnct gtagtacaatnntaaaggcnnntagtaggcgtaataaatttcaccacaaa tctatatcttttaatcgaactcaacataaatattaaattgtcgcgtttgt agcggttttagttctagggttgtgctatccacacatcttcttttacttct cacacactccttgatgatttttgtccattgatctttttcaattcattcga tccgacagttgaaaattaaaaaagtgtnngagaagtaaaatagagtgtgt ggatattataccccttagttctatactttccgcataggcctagtttcgtt catgtattgcaagtagcatcaacattggtccatacaattcgcaaattact gtaattcaatggtaccggtcaaattttgttgaattcttgtatgaagtctg tcaaatttacccttttgtngtaccgtgcacataacgatttggtacaaggt attaacggaagttgaggatgaagngtgtcctcgagttggaacaatttgca atctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac tacatggattaaaaacgtgtttcgggtaaatagcttagtatttagtccaa atttgattctactagtgatttgagtccgannnnnnnnnnntgattcgatt atgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatctga ccggatttaacaaaatgtataatttcgtttaatttgcatttgtttactct acacattatatatgcaggtgacaaaccaagtgtttaggtgtgccaaaaag gcaggggcaagctacat
back to top