LFY1, KT834209.1-LFY1 (gene) Amelanchier arborea

Gene Overview
NameLFY1
Unique NameKT834209.1-LFY1
Typegene
OrganismAmelanchier arborea ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1LFY1Amelanchier arboreagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFY1KT834209.1-LFY1.m1Amelanchier arboreamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreKT834209.1
Alignments
Feature NameTypeLocationAnalysis
KT834209 region KT834209:1..827+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>KT834209.1-LFY1 ID=KT834209.1-LFY1|Name=LFY1|organism=Amelanchier arborea|type=gene|length=827bp
atggtgacggaaccggggnaggtggcacgtggcaaaaagaacggtcttga
ttacctcttccatctctacgagcagtgccgtgatttcttgatccaggtcc
agaacattgccaaggagcgcggtgaaaaatgtccaaccaaggtacggagt
ttacccatgatttcatacgctgatttttactgtattaaatacagtaaact
catcttagactcactgatctttgtgggctcatttcctccaagtacaatta
taaaatagtaggcagtaataaacttgagtggtcctttgtacacccacgtt
tgatttctggacgtccatcaaaaaagaaaaagactcttatactcatatat
aaaattactccaaagactcagtgattgtctaagaaaaacaattgtagggt
tttttttttcactgtattcacctcattgatgcaccttgttgttatggtat
gcactagaaacttagatagttcaaccctaagcattatctacacactcatt
tttacctctcacacgccattctcaattcttggccgtcggatcaaatgaat
taaaaaagatcattggaccaaaattaataagaatgtgtcagagataaaaa
catatgaaaagcactactaaaaacacttctttcctgttatgaacaacaca
ttttcaatcaatttagatttggcaaagtttcactttcgtttatgtatttt
caattacatcgaatttaatacatgtggtctgcaaattttatcaatttaag
aatatccgtcaacttttgtgaatttctcgtacaaaatctattaaatttat
cctcttacaagaaatttacattgttga
back to top

gene from alignment at KT834209:1..827+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KT834209.1-LFY1 ID=KT834209.1-LFY1|Name=LFY1|organism=Amelanchier arborea|type=gene|length=827bp|location=Sequence derived from alignment at KT834209:1..827+ (Amelanchier arborea)
atggtgacggaaccggggnaggtggcacgtggcaaaaagaacggtcttga ttacctcttccatctctacgagcagtgccgtgatttcttgatccaggtcc agaacattgccaaggagcgcggtgaaaaatgtccaaccaaggtacggagt ttacccatgatttcatacgctgatttttactgtattaaatacagtaaact catcttagactcactgatctttgtgggctcatttcctccaagtacaatta taaaatagtaggcagtaataaacttgagtggtcctttgtacacccacgtt tgatttctggacgtccatcaaaaaagaaaaagactcttatactcatatat aaaattactccaaagactcagtgattgtctaagaaaaacaattgtagggt tttttttttcactgtattcacctcattgatgcaccttgttgttatggtat gcactagaaacttagatagttcaaccctaagcattatctacacactcatt tttacctctcacacgccattctcaattcttggccgtcggatcaaatgaat taaaaaagatcattggaccaaaattaataagaatgtgtcagagataaaaa catatgaaaagcactactaaaaacacttctttcctgttatgaacaacaca ttttcaatcaatttagatttggcaaagtttcactttcgtttatgtatttt caattacatcgaatttaatacatgtggtctgcaaattttatcaatttaag aatatccgtcaacttttgtgaatttctcgtacaaaatctattaaatttat cctcttacaagaaatttacattgttga
back to top