LFY1, KT834201.1-LFY1 (gene) Amelanchier arborea

Gene Overview
NameLFY1
Unique NameKT834201.1-LFY1
Typegene
OrganismAmelanchier arborea ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1LFY1Amelanchier arboreagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFY1KT834201.1-LFY1.m1Amelanchier arboreamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreKT834201.1
Alignments
Feature NameTypeLocationAnalysis
KT834201 region KT834201:1..963+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>KT834201.1-LFY1 ID=KT834201.1-LFY1|Name=LFY1|organism=Amelanchier arborea|type=gene|length=963bp
atggtgacggagccgggggaggtggcacgtggcaaaaagaacggtcttga
ttacctcttccatctctacgagcagtgccgtgatttcttgatccaggtcc
agaacattgccaaggagcgcggtgaaaaatgtccaaccaaggtacggagt
ttaccgatgatttcatacgctgatttttactgtattaaatacagtaaact
catcttagactcactgatctttgtgggctcatttcctccaagtacaatta
taaaatagtaggcagtaataaacttgagtggtcctttgtacacccacgtt
tgatttctggacgtccatcaaaaaagaaaaagactcttatactcatatat
aaaattactccaaagactcagtgattgtctaagaaaaacaattgtagggt
tttttttttcactgtattcacctcattgatgcaccttgttgttatggtat
gcactagaaacttagatagttcaaccctaagcattatctacacactcatt
tttacctctcacacgccattctcaattcttggccgtcggatcaaatgaat
taaaaaagatcattggaccaaaattaataagaatgtgtcagagataaaaa
catatgaaaagcactactaaaaacacttctttcctgttatgaacaacaca
ttttcaatcaatttagatttggcaaagtttcactttcgtttatgtatttt
caattacatcgaatttaatacatgtggtctgcaaattttatcaatttaag
aatatccgtcaacttttgtgaatttctcgtacaaaatctattaaatttat
cctcttacaagaaatttacattgctgatgaatattctttgaattggaact
actttcttacatcatgagtcaatttgatgcaatcgaaaatacatgaatga
aagtaggtcagtttgtagtccaaattaatttgattcaactatttagttcg
actaatttaattt
back to top

gene from alignment at KT834201:1..963+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KT834201.1-LFY1 ID=KT834201.1-LFY1|Name=LFY1|organism=Amelanchier arborea|type=gene|length=963bp|location=Sequence derived from alignment at KT834201:1..963+ (Amelanchier arborea)
atggtgacggagccgggggaggtggcacgtggcaaaaagaacggtcttga ttacctcttccatctctacgagcagtgccgtgatttcttgatccaggtcc agaacattgccaaggagcgcggtgaaaaatgtccaaccaaggtacggagt ttaccgatgatttcatacgctgatttttactgtattaaatacagtaaact catcttagactcactgatctttgtgggctcatttcctccaagtacaatta taaaatagtaggcagtaataaacttgagtggtcctttgtacacccacgtt tgatttctggacgtccatcaaaaaagaaaaagactcttatactcatatat aaaattactccaaagactcagtgattgtctaagaaaaacaattgtagggt tttttttttcactgtattcacctcattgatgcaccttgttgttatggtat gcactagaaacttagatagttcaaccctaagcattatctacacactcatt tttacctctcacacgccattctcaattcttggccgtcggatcaaatgaat taaaaaagatcattggaccaaaattaataagaatgtgtcagagataaaaa catatgaaaagcactactaaaaacacttctttcctgttatgaacaacaca ttttcaatcaatttagatttggcaaagtttcactttcgtttatgtatttt caattacatcgaatttaatacatgtggtctgcaaattttatcaatttaag aatatccgtcaacttttgtgaatttctcgtacaaaatctattaaatttat cctcttacaagaaatttacattgctgatgaatattctttgaattggaact actttcttacatcatgagtcaatttgatgcaatcgaaaatacatgaatga aagtaggtcagtttgtagtccaaattaatttgattcaactatttagttcg actaatttaattt
back to top