SFB12, KR149308.1-SFB12 (gene) Eriobotrya japonica

Gene Overview
NameSFB12
Unique NameKR149308.1-SFB12
Typegene
OrganismEriobotrya japonica ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
SFB12SFB12Eriobotrya japonicagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
SFB12KR149308.1-SFB12.m1Eriobotrya japonicamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreKR149308.1
Alignments
Feature NameTypeLocationAnalysis
KR149308 region KR149308:1..1135+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>KR149308.1-SFB12 ID=KR149308.1-SFB12|Name=SFB12|organism=Eriobotrya japonica|type=gene|length=1135bp
atgtctcaggtgtgtgaaagtgaaactcctgaagatagaacggtcgaaat
cttgtccaggttaccacccaagtctctgatgcgattcaaatgcatacgca
aatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctc
agcgattctgtggacaacaaactctcatcctccacttgtatccttctcaa
ctgttctcaggctcacgtttgctcggaagagagttggaaacaagaagtta
tatggtccgtgattaatctttccattgatggcgatgagcttcattatgat
attgaggacctaactaatgtaccgtttctaaaggatgaccatcatgaagt
agagattcacggttattgcgacgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgat
tcatgccttcttctaccccttcccggggtaaaagaaaaatttggattgga
aacgacccttaaaggtctgggatttggttatgattgcaaagctaaagaat
acaaggttgtgcgaattatagataattatgattgtgagtattcagatgat
ggagaaacatatatcgagcatattgctcttcctcacactgctgaagtata
caccatggccgctaactcttggaaagagatcacgattgatatattaagta
aaatattatcatcatatagcgaaccatattcttattcagtgtgtttgaaa
gggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagagttgccttttaggggag
aattcggttttaagcgtgatggtatttttctgtataatgaatccatcact
tattattgcactagttacgaggagccttccacattatttgaaatatgggt
aatggactacgatgacggatttaagagttcatggacaaaacacctaacag
ctggaccttttaaagacatggagtttccattgacaccttggaaacgtgac
gagcttcttatgattacctccgatggaagagctgcctcttataattcttg
taccgaaaatttcaagtatcttcatattcctgcga
back to top

gene from alignment at KR149308:1..1135+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KR149308.1-SFB12 ID=KR149308.1-SFB12|Name=SFB12|organism=Eriobotrya japonica|type=gene|length=1135bp|location=Sequence derived from alignment at KR149308:1..1135+ (Eriobotrya japonica)
atgtctcaggtgtgtgaaagtgaaactcctgaagatagaacggtcgaaat cttgtccaggttaccacccaagtctctgatgcgattcaaatgcatacgca aatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctc agcgattctgtggacaacaaactctcatcctccacttgtatccttctcaa ctgttctcaggctcacgtttgctcggaagagagttggaaacaagaagtta tatggtccgtgattaatctttccattgatggcgatgagcttcattatgat attgaggacctaactaatgtaccgtttctaaaggatgaccatcatgaagt agagattcacggttattgcgacgggattgtttgtgtaacagtagacgaaa atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgat tcatgccttcttctaccccttcccggggtaaaagaaaaatttggattgga aacgacccttaaaggtctgggatttggttatgattgcaaagctaaagaat acaaggttgtgcgaattatagataattatgattgtgagtattcagatgat ggagaaacatatatcgagcatattgctcttcctcacactgctgaagtata caccatggccgctaactcttggaaagagatcacgattgatatattaagta aaatattatcatcatatagcgaaccatattcttattcagtgtgtttgaaa gggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt tgatttagctaatgaaatatctgatatgatagagttgccttttaggggag aattcggttttaagcgtgatggtatttttctgtataatgaatccatcact tattattgcactagttacgaggagccttccacattatttgaaatatgggt aatggactacgatgacggatttaagagttcatggacaaaacacctaacag ctggaccttttaaagacatggagtttccattgacaccttggaaacgtgac gagcttcttatgattacctccgatggaagagctgcctcttataattcttg taccgaaaatttcaagtatcttcatattcctgcga
back to top