GAPDH, KM353347.1-GAPDH (gene) Rosa laevigata

Gene Overview
Unique NameKM353347.1-GAPDH
OrganismRosa laevigata ()
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa laevigatagene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHKM353347.1-GAPDH.m1Rosa laevigatamRNA

Cross References
External references for this gene
Feature NameTypeLocationAnalysis
KM353347 region KM353347:1..762+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

gene sequence

>KM353347.1-GAPDH ID=KM353347.1-GAPDH|Name=GAPDH|organism=Rosa laevigata|type=gene|length=762bp
back to top

gene from alignment at KM353347:1..762+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KM353347.1-GAPDH ID=KM353347.1-GAPDH|Name=GAPDH|organism=Rosa laevigata|type=gene|length=762bp|location=Sequence derived from alignment at KM353347:1..762+ (Rosa laevigata)
catcactggtgagttttcacttgtgaccatgtgagatatatgaatgttaa tcatttgcatgttttgaaaccaactgaagttgtctgtgtgtttgtaattc agccacccagaagactgttgatggaccatcagccaaggactggagaggtg gacgtgctgcctcattcaacatcattcccagcagcactggagctgccaag gtattttcaatattctttatgtgactgcttcagtattgttgatacatttt taagttacgtgtcaaatgatacttcatctttaacagctttattaatcctt gattttggaatgtgtttaggctgttggaaaggttctgcctgctctcaatg gcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagtt gttgacctcactgtcaggcttgagaaggcggcaacctatgaccagatcaa ggctgctatcaagtaaggcttgttgaactttgttgttaatcagttgcaat caaggtggggtgtcatgacattacaatgcatgtgttggttttaatctttt atctttaattctgtctcaacagggaggagtctgagggaaagttgaagggc atcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtga cagcaggtaaatgaatattagtcattcaatggttggagtactatgtacag aataaaccatctaatcctgtttggattagtgatcatcttgaagttgcagt gttgaatttatt
back to top