GAPDH, KM353301.1-GAPDH (gene) Rosa odorata var. gigantea

Gene Overview
NameGAPDH
Unique NameKM353301.1-GAPDH
Typegene
OrganismRosa odorata var. gigantea ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa odorata var. giganteagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHKM353301.1-GAPDH.m1Rosa odorata var. giganteamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreKM353301.1
Alignments
Feature NameTypeLocationAnalysis
KM353301 region KM353301:1..757+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>KM353301.1-GAPDH ID=KM353301.1-GAPDH|Name=GAPDH|organism=Rosa odorata var. gigantea|type=gene|length=757bp
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaa
gatactagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagc
cacccagaagactgttgatggaccatcagcaaaggactggagaggtggac
gtgctgcctcattcaacatcattcccagcagcactggagctgccaaggta
ttttcaatattctttgtgccactgcttcagtattgttgatacacttttaa
gttgcatgtcagtgatacttcatctgtaacagctttattaatccttgatt
ttggaatatctttaggctgtcggcaaggtactgcctgctctcaatggcaa
gttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggct
gctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaag
gtggggtgtcatcacattacaatgcgtgtcttggttctaatcttttatct
ttaattctgtctgaatagggaggagtctgagggaaagttgaagggcatct
tgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaac
aggtaaatgaatattagtcatttaatggttggagtactacgtacagaata
aaccatctatgctgtttggattagtgatcatcttgaagttgcagtggtga
atttatt
back to top

gene from alignment at KM353301:1..757+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KM353301.1-GAPDH ID=KM353301.1-GAPDH|Name=GAPDH|organism=Rosa odorata var. gigantea|type=gene|length=757bp|location=Sequence derived from alignment at KM353301:1..757+ (Rosa odorata var. gigantea)
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaa gatactagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagc cacccagaagactgttgatggaccatcagcaaaggactggagaggtggac gtgctgcctcattcaacatcattcccagcagcactggagctgccaaggta ttttcaatattctttgtgccactgcttcagtattgttgatacacttttaa gttgcatgtcagtgatacttcatctgtaacagctttattaatccttgatt ttggaatatctttaggctgtcggcaaggtactgcctgctctcaatggcaa gttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggct gctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaag gtggggtgtcatcacattacaatgcgtgtcttggttctaatcttttatct ttaattctgtctgaatagggaggagtctgagggaaagttgaagggcatct tgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaac aggtaaatgaatattagtcatttaatggttggagtactacgtacagaata aaccatctatgctgtttggattagtgatcatcttgaagttgcagtggtga atttatt
back to top