GAPDH, KJ575378.1-GAPDH (gene) Rosa helenae

Gene Overview
NameGAPDH
Unique NameKJ575378.1-GAPDH
Typegene
OrganismRosa helenae ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa helenaegene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHKJ575378.1-GAPDH.m1Rosa helenaemRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreKJ575378.1
Alignments
Feature NameTypeLocationAnalysis
KJ575378 region KJ575378:1..674+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>KJ575378.1-GAPDH ID=KJ575378.1-GAPDH|Name=GAPDH|organism=Rosa helenae|type=gene|length=674bp
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaacc
atgtgatatatatgaatgttaagatactagattcgaaaccaactaaagtc
gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca
gcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccag
cagcactggagctgccaaggtattttcaatattctttgtgccactgcttc
agtattgttgatacacttgtaagttacatgtcagtgatacttcatctgta
acagctttattaatccttgatttgggaatatctttaggctgtcgggaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc
aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg
ttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatg
tcttggttctaatcttttatctttaattctgtccgaacagggaggagtct
gagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtc
aaccgacttcattggtgacaacag
back to top

gene from alignment at KJ575378:1..674+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ575378.1-GAPDH ID=KJ575378.1-GAPDH|Name=GAPDH|organism=Rosa helenae|type=gene|length=674bp|location=Sequence derived from alignment at KJ575378:1..674+ (Rosa helenae)
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaacc atgtgatatatatgaatgttaagatactagattcgaaaccaactaaagtc gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca gcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccag cagcactggagctgccaaggtattttcaatattctttgtgccactgcttc agtattgttgatacacttgtaagttacatgtcagtgatacttcatctgta acagctttattaatccttgatttgggaatatctttaggctgtcgggaagg ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg ttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatg tcttggttctaatcttttatctttaattctgtccgaacagggaggagtct gagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtc aaccgacttcattggtgacaacag
back to top