GAPDH, KJ575370.1-GAPDH (gene) Rosa gallica

Gene Overview
Unique NameKJ575370.1-GAPDH
OrganismRosa gallica ()
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa gallicagene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHKJ575370.1-GAPDH.m1Rosa gallicamRNA

Cross References
External references for this gene
Feature NameTypeLocationAnalysis
KJ575370 region KJ575370:1..673+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

gene sequence

>KJ575370.1-GAPDH ID=KJ575370.1-GAPDH|Name=GAPDH|organism=Rosa gallica|type=gene|length=673bp
back to top

gene from alignment at KJ575370:1..673+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ575370.1-GAPDH ID=KJ575370.1-GAPDH|Name=GAPDH|organism=Rosa gallica|type=gene|length=673bp|location=Sequence derived from alignment at KJ575370:1..673+ (Rosa gallica)
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaacc atgtgagatatatgaatgttaaatactaggtttgaaaccaactaaagtcg tctgtgtatttgcaattcagccacccagaagactgttgatggaccatcag caaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc agcactggagctgccaaggtattttcaatattctttgtgccattgcttca gtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaa cagctttattaatccttgattttggaatatctttaggctgtcggaaaggt tctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccca ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggca acctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgt tgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgt cttggttctaatcttttatctttaattctgtctgaacagggaggagtctg agggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtca accgacttcattggtgacaatag
back to top