GAPDH, KJ575353.1-GAPDH (gene) Rosa canina

Gene Overview
NameGAPDH
Unique NameKJ575353.1-GAPDH
Typegene
OrganismRosa canina ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa caninagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHKJ575353.1-GAPDH.m1Rosa caninamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreKJ575353.1
Alignments
Feature NameTypeLocationAnalysis
KJ575353 region KJ575353:1..673+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>KJ575353.1-GAPDH ID=KJ575353.1-GAPDH|Name=GAPDH|organism=Rosa canina|type=gene|length=673bp
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaacc
atgtgaggtatatgaatgttaaatactaggtttgaaaccaactaaagtcg
tctgtgtatttgcaattcagccacccagaagactgttgatggaccatcag
caaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggtattttcaatagtctttgtgccactgcttca
gtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaa
cagctttattaatccttgattttggaatatctttaggctgtcggaaaggt
tctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccca
ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggca
acctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgt
tgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgt
cttggttctaatcttttatctttaattctgtctgaacagggaggagtctg
agggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtca
accgacttcattggtgacaatag
back to top

gene from alignment at KJ575353:1..673+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ575353.1-GAPDH ID=KJ575353.1-GAPDH|Name=GAPDH|organism=Rosa canina|type=gene|length=673bp|location=Sequence derived from alignment at KJ575353:1..673+ (Rosa canina)
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaacc atgtgaggtatatgaatgttaaatactaggtttgaaaccaactaaagtcg tctgtgtatttgcaattcagccacccagaagactgttgatggaccatcag caaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc agcactggagctgccaaggtattttcaatagtctttgtgccactgcttca gtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaa cagctttattaatccttgattttggaatatctttaggctgtcggaaaggt tctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccca ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggca acctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgt tgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgt cttggttctaatcttttatctttaattctgtctgaacagggaggagtctg agggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtca accgacttcattggtgacaatag
back to top