RPL3, KC825072.1-RPL3 (gene) Dasiphora fruticosa subsp. floribunda

Gene Overview
NameRPL3
Unique NameKC825072.1-RPL3
Typegene
OrganismDasiphora fruticosa subsp. floribunda ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
RPL3RPL3Dasiphora fruticosa subsp. floribundagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
RPL3KC825072.1-RPL3.m1Dasiphora fruticosa subsp. floribundamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreKC825072.1
Alignments
Feature NameTypeLocationAnalysis
KC825072 region KC825072:1..1583+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>KC825072.1-RPL3 ID=KC825072.1-RPL3|Name=RPL3|organism=Dasiphora fruticosa subsp. floribunda|type=gene|length=1583bp
tggtaaatcantgtatcaagatgtcaatctgagatcttatttcggttcga
tacgtccacctacgagactgacctttggctttcgtctcggtacgtgtatt
attctacattttccaaaaagagcattcattcatttctttcttccccgtcg
accacgacgactgaaacgacgcgaaaaatcnagacccggaaaggagtggt
gggcttttgggaaagtcgggccgatcaggtgtcttcattcaagcgacgat
acagaagaagaacgaaacgaagtgagaggccgggnggcagngaaaagagt
cgagtcgatcaggctcgacgaccgggagaagcaaaacgaaattcggattt
ggccgaaaaagaagcaacgctatggataccatgaccgatcaccatcgata
aagaagaatctttctaaatcacttcgggtcagcngggccntcaagcatcc
nnnnnnnnnnnnnnnnnnnnnnnnnnnagcgttcctgatagaaaatgacg
actccttcagaaaaacnaagttattnaagttntttttnccannnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnngaattattcagtcatgcaatacttattgaatacaaagaaccaaatta
atttagaccccgtcgtagttttcaatcatttcgtggcaccgagcgtgtct
gaaccatctacgatggggggagcgaatgcacagggaagaagcttagataa
gagaatacgttctcgcatcgctttttttgtagaaagctcgaccagcgaga
aaaagtntttgnccgaagccaaaaagaggttgacccacttcannnnnnna
gcgaatgatcttcgcttcgcgggaacaacaaaaaccaccatctcgctctt
tccttttttcggtgctacctttttctttccaagggatggggttgggatgt
ataataaccttttttttgaagatgcccgggaacaactcctaggtcnnnnn
nnnnnnnnnnnnnnnnnnnncatgggtaaggatanngtaatngaattgat
agagaaattcatagacctaggtaggataggagaattgataaagggaatag
agatgatgatagagatcatactgagaaacagnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatag
aacaaacactaatatcttaattgagtcggtcaagataaaatctgtttatc
aaagtgcttctccgattgctcaagacatctcttttcaactgagaaacaaa
acaagatcatttcgttccatttttagtaaaanngtgaaggatattnnnnn
nnnaatgaaaannnnnnnnnnnnngatccgtatatgttgttcaggtcgat
taaaaggcgcagaaatagctagaactgaatgcggaaagtatggaaaaaca
tctcgtaatgtatttaaccagaaaatagattatgctcctgcggaagtatc
tactcgttatggaatcttaggtgtcaaagtgtggatttcatatagtaaaa
aaaagggacgtgctatatccgaaacgtacgaaa
back to top

gene from alignment at KC825072:1..1583+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KC825072.1-RPL3 ID=KC825072.1-RPL3|Name=RPL3|organism=Dasiphora fruticosa subsp. floribunda|type=gene|length=1583bp|location=Sequence derived from alignment at KC825072:1..1583+ (Dasiphora fruticosa subsp. floribunda)
tggtaaatcantgtatcaagatgtcaatctgagatcttatttcggttcga tacgtccacctacgagactgacctttggctttcgtctcggtacgtgtatt attctacattttccaaaaagagcattcattcatttctttcttccccgtcg accacgacgactgaaacgacgcgaaaaatcnagacccggaaaggagtggt gggcttttgggaaagtcgggccgatcaggtgtcttcattcaagcgacgat acagaagaagaacgaaacgaagtgagaggccgggnggcagngaaaagagt cgagtcgatcaggctcgacgaccgggagaagcaaaacgaaattcggattt ggccgaaaaagaagcaacgctatggataccatgaccgatcaccatcgata aagaagaatctttctaaatcacttcgggtcagcngggccntcaagcatcc nnnnnnnnnnnnnnnnnnnnnnnnnnnagcgttcctgatagaaaatgacg actccttcagaaaaacnaagttattnaagttntttttnccannnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnngaattattcagtcatgcaatacttattgaatacaaagaaccaaatta atttagaccccgtcgtagttttcaatcatttcgtggcaccgagcgtgtct gaaccatctacgatggggggagcgaatgcacagggaagaagcttagataa gagaatacgttctcgcatcgctttttttgtagaaagctcgaccagcgaga aaaagtntttgnccgaagccaaaaagaggttgacccacttcannnnnnna gcgaatgatcttcgcttcgcgggaacaacaaaaaccaccatctcgctctt tccttttttcggtgctacctttttctttccaagggatggggttgggatgt ataataaccttttttttgaagatgcccgggaacaactcctaggtcnnnnn nnnnnnnnnnnnnnnnnnnncatgggtaaggatanngtaatngaattgat agagaaattcatagacctaggtaggataggagaattgataaagggaatag agatgatgatagagatcatactgagaaacagnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatag aacaaacactaatatcttaattgagtcggtcaagataaaatctgtttatc aaagtgcttctccgattgctcaagacatctcttttcaactgagaaacaaa acaagatcatttcgttccatttttagtaaaanngtgaaggatattnnnnn nnnaatgaaaannnnnnnnnnnnngatccgtatatgttgttcaggtcgat taaaaggcgcagaaatagctagaactgaatgcggaaagtatggaaaaaca tctcgtaatgtatttaaccagaaaatagattatgctcctgcggaagtatc tactcgttatggaatcttaggtgtcaaagtgtggatttcatatagtaaaa aaaagggacgtgctatatccgaaacgtacgaaa
back to top