LFY2, KT834248.1-LFY2.m1 (mRNA) Amelanchier arborea

Transcript Overview
Unique NameKT834248.1-LFY2.m1
OrganismAmelanchier arborea ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY2KT834248.1-LFY2Amelanchier arboreagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY2LFY2Amelanchier arboreagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KT834248.1-LFY2.m1-cds1KT834248.1-LFY2.m1-cds1Amelanchier arboreaCDS
KT834248.1-LFY2.m1-cds2KT834248.1-LFY2.m1-cds2Amelanchier arboreaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFY2KT834248.1-LFY2.p1Amelanchier arboreapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KT834248 region KT834248:1..1067+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>KT834248.1-LFY2.m1 ID=KT834248.1-LFY2.m1|Name=LFY2|organism=Amelanchier arborea|type=mRNA|length=197bp
back to top

protein sequence of LFY2

>KT834248.1-LFY2.p1 ID=KT834248.1-LFY2.p1|Name=LFY2|organism=Amelanchier arborea|type=polypeptide|length=65bp
back to top

mRNA from alignment at KT834248:1..1067+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KT834248.1-LFY2.m1 ID=KT834248.1-LFY2.m1|Name=LFY2|organism=Amelanchier arborea|type=mRNA|length=1067bp|location=Sequence derived from alignment at KT834248:1..1067+ (Amelanchier arborea)
ccgttcatggtgacggagccgggggaggtggcgcgtggcaaaaagaacgg cctcgattacctcttccatctgtacgagcaatgccgcgatttcctgatcc aggtccagaacattgccaagcagcgcggtgaaaaatgtcccaccaaggta cgaagttttacccatctcccttttacgtacgctgatttctactgtagaaa ataacagtaccttcaccatgttagtcatcgatctgtgggctcattttnct gtagtacaaanntaaaggctagtagtaggcgtaataaatttcaccacaaa tctatatcttttaatcgaactcaacataaatattaaattgtcgcgtttgt agcggttctagttctagggttgtgctatccacacatcttattttacttct cacacacttcttgatgatttttgtccattgatctttttcaattcattcga tccgacggttgaaaattaaaaaagtgtnngagaagtaaaatagagtgtgt ggatattataccccttagttctatactttccgcataggcctagtttcgtt catgtattgcaagtagcatcaacattggtccatacaattcgcaaattact gtaattcaatggtaccggtcaaattttgttgaattcttgtatgaagtctg tcaaatttacccttttgtngtaccgtgcacagaacgatttggtacaaggt attaacggaagttgaggatgaagggtgtcctcgagttggaacaatttgca atctacatggactaaattagatgaaattaaacgcaggtctttgtgaaaac tacatggattaaaaacgtgtttcgggtaaatagctcagtatttagtccaa atttaattctactagtgatttgagtccgannnnnnnnnnntgattcgatt atgatgtaatcaaatacgtgttaagaaaaatgtacgcaattataatatga ccggatctaacaaaatgtataatttcgtttaatttgcatttgtttactct acacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaag gcaggggcaagctacat
back to top

Coding sequence (CDS) from alignment at KT834248:1..1067+

>KT834248.1-LFY2.m1 ID=KT834248.1-LFY2.m1|Name=LFY2|organism=Amelanchier arborea|type=CDS|length=197bp|location=Sequence derived from alignment at KT834248:1..1067+ (Amelanchier arborea)
back to top