DREB2, JQ086364.1-DREB2.m1 (mRNA) Malus sieversii

Transcript Overview
Unique NameJQ086364.1-DREB2.m1
OrganismMalus sieversii ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
DREB2DREB2Malus sieversiigene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JQ086364.1-DREB2.m1-cds1JQ086364.1-DREB2.m1-cds1Malus sieversiiCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
DREB2JQ086364.1-DREB2.p1Malus sieversiipolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JQ086364 region JQ086364:1..1197+ NCBI Rosaceae gene and mRNA sequences
Chr01 chromosome Chr01:26531657..26532853- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Property NameValue
ProductDREB2 transcription factor
The following sequences are available for this feature:

mRNA sequence

>JQ086364.1-DREB2.m1 ID=JQ086364.1-DREB2.m1|Name=DREB2|organism=Malus sieversii|type=mRNA|length=1197bp
back to top

protein sequence of DREB2

>JQ086364.1-DREB2.p1 ID=JQ086364.1-DREB2.p1|Name=DREB2|organism=Malus sieversii|type=polypeptide|length=398bp
back to top

mRNA from alignment at JQ086364:1..1197+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ086364.1-DREB2.m1 ID=JQ086364.1-DREB2.m1|Name=DREB2|organism=Malus sieversii|type=mRNA|length=1197bp|location=Sequence derived from alignment at JQ086364:1..1197+ (Malus sieversii)
atgggagcttatgatcaaggcgctaacatgtcatctctgcccttggattc ttcaaggaagaggaagacgcggagcaggcgagatgggaactctgttgctg agacactagaaaagtggaaagagtataataagaaactggaatcagttaat aacgaggggaaaacgcgtaaagtgcccgccaaggggtcgaagaaaggctg tatgaaaggcaagggagggcctgagaatgcacgttgcaattacagaggtg tgaggcaaaggacttggggcaagtgggtcgccgagattcgggagccagac aggggaagcaggctttggttgggtacttttcccactgcccttgatgctgc ccttgcgtatgatgaggctgcgaaggccatgtatggtactggtgctcgcc tcaacctcccgcatgcggccaattatcatccatcgtcttcactggagact tcttcagttgcaacaccatcagggtcttctgcagtggcaactccaggatg ctctacttccacttcaacctcaagtcgctctgagatttgtggagacgagg attccaagctttttcttaatgtgaaaaaggaggatggtgagggcgaatca aggatgtatccgtggtctactgcggtccctcaagccagtggtatggttaa gccagaaatcattgaggatttcactatggattatcttcgtaataatcaac aacaacctgtcgtcaaaccggaagcaggagttgaggatcataattggaat ggcggagaaggttttattggggattattcagagaacttcacaaccgacga gttgtttgatatggatgagatgtttgatgtaaatgaactgttgatgcctt cagatgatatttccctttgcaattcaggatcggagcaagtttggagagct gacgttggtcagtcgggcatggagactctcagcagtgagaggccatcaaa tttatcgtaccagctgcagtttccagacgccaagctgctcgggagtctgc agcacatggagcatgccccattgaacttcgaatacggttttgatttcaag aagcaagaaaaggaggggagtaatcataccggccaagatgatcaagggta cttcaatctgggattgtctgacttagatttggaaggattcacaggaggaa taacacaatccggagatggaggttacaactattcgatggaaatgtga
back to top

Coding sequence (CDS) from alignment at JQ086364:1..1197+

>JQ086364.1-DREB2.m1 ID=JQ086364.1-DREB2.m1|Name=DREB2|organism=Malus sieversii|type=CDS|length=1197bp|location=Sequence derived from alignment at JQ086364:1..1197+ (Malus sieversii)
back to top