MYB20, KT159236.1-MYB20.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameKT159236.1-MYB20.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
MYB20MYB20Prunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KT159236.1-MYB20.m1-cds1KT159236.1-MYB20.m1-cds1Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MYB20KT159236.1-MYB20.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KT159236 region KT159236:1..951+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductR2R3-MYB transcription factor
The following sequences are available for this feature:

mRNA sequence

>KT159236.1-MYB20.m1 ID=KT159236.1-MYB20.m1|Name=MYB20|organism=Prunus persica|type=mRNA|length=951bp
back to top

protein sequence of MYB20

>KT159236.1-MYB20.p1 ID=KT159236.1-MYB20.p1|Name=MYB20|organism=Prunus persica|type=polypeptide|length=316bp
back to top

mRNA from alignment at KT159236:1..951+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KT159236.1-MYB20.m1 ID=KT159236.1-MYB20.m1|Name=MYB20|organism=Prunus persica|type=mRNA|length=951bp|location=Sequence derived from alignment at KT159236:1..951+ (Prunus persica)
atggggaggtcaccttgctgtgagaaagctcacaccaacaaaggcgcttg gaccaaagaagaagaccagcgcctcatcgattacatccgcgtccatggcg aaggctgctggcgctccctccccaaagccgctgggttgcttaggtgcggc aagagctgtaggctgagatggataaactaccttcgccctgacctcaagcg tggaaatttcacagaagaagaagatgagctcatcatcaagctccatagct tacttggaaacaagtggtcattgattgcggggcgattgccgggaagaacc gacaacgaaataaaaaactactggaatacacacatcaagcggaagctcat cagccgtggcctcgaccctcaaacccaccgtccgctcaacgacaccacaa ccgcagcggcggcagcggccgccacgacacctgcttctcgcttagatttc agaaacatttctccgccatccgccgtcgtcgataaaaccaccaacaaaaa ttccatattgcatcacaaaaccatcaacaaaacctcctcgaacaacaaca accacaacagcaatatcgtattgttcaagcccaagatggaagaggacaac atagaagaggccagcagtgggaccaccacagaggaagaccaacaacaaca acaacaacagcaacagcagaaattgcaagatcattatatgtacaagtgta gtgacctcaacttggatctttcaattgggctggagcccttccagtccgag ccaactcgggcttcgtcggggaactcggccgagtcaagactgcagcagaa taattaccaggtttttgggacagtgcataaggcgggggtgactcaggcgg tgtgtttgtgttgtcaggttggattccagagcagcgacgcttgtaggaat tgtcagtgcacaaatgggttctacagatttcacagacctttgaattcata g
back to top

Coding sequence (CDS) from alignment at KT159236:1..951+

>KT159236.1-MYB20.m1 ID=KT159236.1-MYB20.m1|Name=MYB20|organism=Prunus persica|type=CDS|length=951bp|location=Sequence derived from alignment at KT159236:1..951+ (Prunus persica)
back to top