SFB12, KR149308.1-SFB12.m1 (mRNA) Eriobotrya japonica

Transcript Overview
Unique NameKR149308.1-SFB12.m1
OrganismEriobotrya japonica ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
SFB12KR149308.1-SFB12Eriobotrya japonicagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
SFB12SFB12Eriobotrya japonicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KR149308.1-SFB12.m1-cds1KR149308.1-SFB12.m1-cds1Eriobotrya japonicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
SFB12KR149308.1-SFB12.p1Eriobotrya japonicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KR149308 region KR149308:1..1135+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductS-haplotype-specific F-box protein
The following sequences are available for this feature:

mRNA sequence

>KR149308.1-SFB12.m1 ID=KR149308.1-SFB12.m1|Name=SFB12|organism=Eriobotrya japonica|type=mRNA|length=1135bp
back to top

protein sequence of SFB12

>KR149308.1-SFB12.p1 ID=KR149308.1-SFB12.p1|Name=SFB12|organism=Eriobotrya japonica|type=polypeptide|length=378bp
back to top

mRNA from alignment at KR149308:1..1135+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KR149308.1-SFB12.m1 ID=KR149308.1-SFB12.m1|Name=SFB12|organism=Eriobotrya japonica|type=mRNA|length=1135bp|location=Sequence derived from alignment at KR149308:1..1135+ (Eriobotrya japonica)
atgtctcaggtgtgtgaaagtgaaactcctgaagatagaacggtcgaaat cttgtccaggttaccacccaagtctctgatgcgattcaaatgcatacgca aatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctc agcgattctgtggacaacaaactctcatcctccacttgtatccttctcaa ctgttctcaggctcacgtttgctcggaagagagttggaaacaagaagtta tatggtccgtgattaatctttccattgatggcgatgagcttcattatgat attgaggacctaactaatgtaccgtttctaaaggatgaccatcatgaagt agagattcacggttattgcgacgggattgtttgtgtaacagtagacgaaa atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgat tcatgccttcttctaccccttcccggggtaaaagaaaaatttggattgga aacgacccttaaaggtctgggatttggttatgattgcaaagctaaagaat acaaggttgtgcgaattatagataattatgattgtgagtattcagatgat ggagaaacatatatcgagcatattgctcttcctcacactgctgaagtata caccatggccgctaactcttggaaagagatcacgattgatatattaagta aaatattatcatcatatagcgaaccatattcttattcagtgtgtttgaaa gggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt tgatttagctaatgaaatatctgatatgatagagttgccttttaggggag aattcggttttaagcgtgatggtatttttctgtataatgaatccatcact tattattgcactagttacgaggagccttccacattatttgaaatatgggt aatggactacgatgacggatttaagagttcatggacaaaacacctaacag ctggaccttttaaagacatggagtttccattgacaccttggaaacgtgac gagcttcttatgattacctccgatggaagagctgcctcttataattcttg taccgaaaatttcaagtatcttcatattcctgcga
back to top

Coding sequence (CDS) from alignment at KR149308:1..1135+

>KR149308.1-SFB12.m1 ID=KR149308.1-SFB12.m1|Name=SFB12|organism=Eriobotrya japonica|type=CDS|length=1135bp|location=Sequence derived from alignment at KR149308:1..1135+ (Eriobotrya japonica)
back to top