RAN4, KP148823.1-RAN4.m1 (mRNA) Prunus salicina

Transcript Overview
Unique NameKP148823.1-RAN4.m1
OrganismPrunus salicina ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
RAN4RAN4Prunus salicinagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KP148823.1-RAN4.m1-cds1KP148823.1-RAN4.m1-cds1Prunus salicinaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
RAN4KP148823.1-RAN4.p1Prunus salicinapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KP148823 region KP148823:1..285+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductGTP-binding protein Ran4
The following sequences are available for this feature:

mRNA sequence

>KP148823.1-RAN4.m1 ID=KP148823.1-RAN4.m1|Name=RAN4|organism=Prunus salicina|type=mRNA|length=285bp
back to top

protein sequence of RAN4

>KP148823.1-RAN4.p1 ID=KP148823.1-RAN4.p1|Name=RAN4|organism=Prunus salicina|type=polypeptide|length=94bp
back to top

mRNA from alignment at KP148823:1..285+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KP148823.1-RAN4.m1 ID=KP148823.1-RAN4.m1|Name=RAN4|organism=Prunus salicina|type=mRNA|length=285bp|location=Sequence derived from alignment at KP148823:1..285+ (Prunus salicina)
gatgtgaagaacaggcaggtcaaggcaaagcaggttactttccacaggaa gaagaatattcagtactatgagatatcagcaaagagcaactataactttg agaagcctttcttatacctcgccagaaagcttgctggggatcataatttg cattttgttgagtcacctccctcggctcctccagaagtacacattgatct ggctgcacaacaacagcaggaagccgagctcgttgcagctgccagccagc cccttcttgatgatgacgatgacacattcgagtag
back to top

Coding sequence (CDS) from alignment at KP148823:1..285+

>KP148823.1-RAN4.m1 ID=KP148823.1-RAN4.m1|Name=RAN4|organism=Prunus salicina|type=CDS|length=285bp|location=Sequence derived from alignment at KP148823:1..285+ (Prunus salicina)
back to top