GAPDH, KJ575382.1-GAPDH.m1 (mRNA) Rosa laevigata

Transcript Overview
Unique NameKJ575382.1-GAPDH.m1
OrganismRosa laevigata ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHKJ575382.1-GAPDHRosa laevigatagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa laevigatagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KJ575382.1-GAPDH.m1-cds1KJ575382.1-GAPDH.m1-cds1Rosa laevigataCDS
KJ575382.1-GAPDH.m1-cds2KJ575382.1-GAPDH.m1-cds2Rosa laevigataCDS
KJ575382.1-GAPDH.m1-cds3KJ575382.1-GAPDH.m1-cds3Rosa laevigataCDS
KJ575382.1-GAPDH.m1-cds4KJ575382.1-GAPDH.m1-cds4Rosa laevigataCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GAPDHKJ575382.1-GAPDH.p1Rosa laevigatapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KJ575382 region KJ575382:1..678+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productglyceraldehyde 3-phosphate dehydrogenase
The following sequences are available for this feature:

mRNA sequence

>KJ575382.1-GAPDH.m1 ID=KJ575382.1-GAPDH.m1|Name=GAPDH|organism=Rosa laevigata|type=mRNA|length=355bp
back to top

protein sequence of GAPDH

>KJ575382.1-GAPDH.p1 ID=KJ575382.1-GAPDH.p1|Name=GAPDH|organism=Rosa laevigata|type=polypeptide|length=117bp
back to top

mRNA from alignment at KJ575382:1..678+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ575382.1-GAPDH.m1 ID=KJ575382.1-GAPDH.m1|Name=GAPDH|organism=Rosa laevigata|type=mRNA|length=678bp|location=Sequence derived from alignment at KJ575382:1..678+ (Rosa laevigata)
gtcttatgactactgtgcactccatcactggtgagttttcacttgtgacc atgtgagatatatgaatgttaatcatttgcatgttttgaaaccaactgaa gttgtctgtgtgtttgtaattcagccacccagaagactgttgatggacca tcagccaaggactggagaggtggacgkgctgcctcattcaacatcattcc cagcagcactggagctgccaaggtattttcaatattctttatgtgactgc ttcagtattgttgatacatttttaagttacgtgtcaaatgatacttcatc tttaacagctttattaatccttgattttggaatgtgtttaggctgttgga aaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgt acccactgttgatgtttcagttgttgacctcactgtcaggcttgagaagg cggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaac tttgttgttaatcagttgcaatcaaggtggggtgtcatgacattacaatg catgtgttggttttaatcttttatctttaattctgtctcaacagggagga gtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttg tgtcaaccgacttcattggtgacagcag
back to top

Coding sequence (CDS) from alignment at KJ575382:1..678+

>KJ575382.1-GAPDH.m1 ID=KJ575382.1-GAPDH.m1|Name=GAPDH|organism=Rosa laevigata|type=CDS|length=355bp|location=Sequence derived from alignment at KJ575382:1..678+ (Rosa laevigata)
back to top