GAPDH, KJ575354.1-GAPDH.m1 (mRNA) Rosa canina

Transcript Overview
Unique NameKJ575354.1-GAPDH.m1
OrganismRosa canina ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHKJ575354.1-GAPDHRosa caninagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa caninagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KJ575354.1-GAPDH.m1-cds1KJ575354.1-GAPDH.m1-cds1Rosa caninaCDS
KJ575354.1-GAPDH.m1-cds2KJ575354.1-GAPDH.m1-cds2Rosa caninaCDS
KJ575354.1-GAPDH.m1-cds3KJ575354.1-GAPDH.m1-cds3Rosa caninaCDS
KJ575354.1-GAPDH.m1-cds4KJ575354.1-GAPDH.m1-cds4Rosa caninaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GAPDHKJ575354.1-GAPDH.p1Rosa caninapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KJ575354 region KJ575354:1..674+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productglyceraldehyde 3-phosphate dehydrogenase
The following sequences are available for this feature:

mRNA sequence

>KJ575354.1-GAPDH.m1 ID=KJ575354.1-GAPDH.m1|Name=GAPDH|organism=Rosa canina|type=mRNA|length=355bp
back to top

protein sequence of GAPDH

>KJ575354.1-GAPDH.p1 ID=KJ575354.1-GAPDH.p1|Name=GAPDH|organism=Rosa canina|type=polypeptide|length=117bp
back to top

mRNA from alignment at KJ575354:1..674+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ575354.1-GAPDH.m1 ID=KJ575354.1-GAPDH.m1|Name=GAPDH|organism=Rosa canina|type=mRNA|length=674bp|location=Sequence derived from alignment at KJ575354:1..674+ (Rosa canina)
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaacc atgtgagatatatgaatgttaagatactagattagaaaccaactaaagtt gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca gcaaaggactggagaggtggacgtgctgcctcgttcaacatcattcccag cagcactggagctgccaaggtattttcaatattctttgtgccactgcttc agtattgttgatacacttttaagttacatgtcagtgatacttcttcttta acagctttattaatccttgattttggaatatgtttaggctgtcggaaagg ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg ttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatg tcttggttttaatcttttgtctttaattctgtctcaacagggaggagtct gagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtc aactgacttcattggtgacaacag
back to top

Coding sequence (CDS) from alignment at KJ575354:1..674+

>KJ575354.1-GAPDH.m1 ID=KJ575354.1-GAPDH.m1|Name=GAPDH|organism=Rosa canina|type=CDS|length=355bp|location=Sequence derived from alignment at KJ575354:1..674+ (Rosa canina)
back to top