XET4, KJ690922.1-XET4.m1 (mRNA) Pyrus x bretschneideri

Transcript Overview
Unique NameKJ690922.1-XET4.m1
OrganismPyrus x bretschneideri ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
XET4XET4Pyrus x bretschneiderigene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KJ690922.1-XET4.m1-cds1KJ690922.1-XET4.m1-cds1Pyrus x bretschneideriCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
XET4KJ690922.1-XET4.p1Pyrus x bretschneideripolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KJ690922 region KJ690922:1..891+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productxyloglucan endotransglucosylase/hydrolase 4
The following sequences are available for this feature:

mRNA sequence

>KJ690922.1-XET4.m1 ID=KJ690922.1-XET4.m1|Name=XET4|organism=Pyrus x bretschneideri|type=mRNA|length=891bp
back to top

protein sequence of XET4

>KJ690922.1-XET4.p1 ID=KJ690922.1-XET4.p1|Name=XET4|organism=Pyrus x bretschneideri|type=polypeptide|length=296bp
back to top

mRNA from alignment at KJ690922:1..891+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ690922.1-XET4.m1 ID=KJ690922.1-XET4.m1|Name=XET4|organism=Pyrus x bretschneideri|type=mRNA|length=891bp|location=Sequence derived from alignment at KJ690922:1..891+ (Pyrus x bretschneideri)
atggctggttcagcttttggaataatggttttttctctaagtgcttttct gagtcttgcattgctgggtttggtcagctcagcaaaatttgatgagcttt tccagccaacctgggctttcgatcatttcacctacgagggagagcaaatt cacatgaaacttgacaacttttccggagctgggtttcaatccaagaacaa gtacctgtttggaaaagtgagccttcagattaagctcatcgagggcgact ctgctggaaccgtcactgctttctatatgtcatcggacggtccacaacac aatgagttcgactttgagtttctggggaacacgacaggggaaccttattc ggtgcagaccaatttatacgtgaatggcgtgggaaacagagaacaaagat tgaacctttggttcgatcccaccacggaattccattcctactccatcttc tggaatcagcgccaagtagtgttcctagtggatgagacgcccattagagt ccacaccaacatggaaaacaaaggagtgccctttcccaaggaccaagcca tgggtgtgtacagttcaatttggaatgcagatgactgggccacacagggt ggtagggtcaagacagattggtcccatgcacccttcattgcaacctacaa gggctttgaaatcaatgcctgtgagtacccagtttccattgcagctgcag ataaggcaaagaagtgcatcagcaatggtggccagaagtactggtgggat gagcctactttgtcagagctaagtgtccaccagaaccaccagctcgtttg ggtgaaggctcaccacatggtctacgactactgcaccgattctgctaggt ttccggtgactccactcgagtgcgtgcatcaccgccactag
back to top

Coding sequence (CDS) from alignment at KJ690922:1..891+

>KJ690922.1-XET4.m1 ID=KJ690922.1-XET4.m1|Name=XET4|organism=Pyrus x bretschneideri|type=CDS|length=891bp|location=Sequence derived from alignment at KJ690922:1..891+ (Pyrus x bretschneideri)
back to top