C4H, JQ622235.1-C4H.m1 (mRNA) Prunus armeniaca

Transcript Overview
Unique NameJQ622235.1-C4H.m1
OrganismPrunus armeniaca (Apricot)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
C4HC4HPrunus armeniacagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JQ622235.1-C4H.m1-cds1JQ622235.1-C4H.m1-cds1Prunus armeniacaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
C4HJQ622235.1-C4H.p1Prunus armeniacapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JQ622235 region JQ622235:1..609+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>JQ622235.1-C4H.m1 ID=JQ622235.1-C4H.m1|Name=C4H|organism=Prunus armeniaca|type=mRNA|length=609bp
back to top

protein sequence of C4H

>JQ622235.1-C4H.p1 ID=JQ622235.1-C4H.p1|Name=C4H|organism=Prunus armeniaca|type=polypeptide|length=203bp
back to top

mRNA from alignment at JQ622235:1..609+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ622235.1-C4H.m1 ID=JQ622235.1-C4H.m1|Name=C4H|organism=Prunus armeniaca|type=mRNA|length=609bp|location=Sequence derived from alignment at JQ622235:1..609+ (Prunus armeniaca)
gcagcggcggtggttgaggacgtaaagaagtacccggggtctgcgaccaa tgggatggtgctgcggaggcggttgcagctgatgatgtacaacaacatgt accggattatgttcgatcggaggttcgagagcgaggatgatcctctgttt atgaagctcaaggggttgaatggggagaggagccgattggctcagagctt cgattacaattatggagattttatccccattttgagacccttcttgagag gctacttgaagatctgcaaagaggtcaaggagaagagaattcggctgttc aaggactactttgtcgatgaacggaagaaactttcaagcacaaaaacgac aacaaatgaaggactgaagtgcgccatcgaccatatcctggacgctcagc agaagggagagatcaacgaggacaacgtcctttacatcgtcgagaacatc aacgttgctgcaattgaaacaacactatggtcaattgagtgggggattgc agagcttgtgaaccaccctgagatccaaaagaagctgagggatgagcttg actcagtgcttggccctggtgttcaaatcacagagccagagatccagaag cttccctac
back to top

Coding sequence (CDS) from alignment at JQ622235:1..609+

>JQ622235.1-C4H.m1 ID=JQ622235.1-C4H.m1|Name=C4H|organism=Prunus armeniaca|type=CDS|length=609bp|location=Sequence derived from alignment at JQ622235:1..609+ (Prunus armeniaca)
back to top