RPL3, KC825072.1-RPL3.m1 (mRNA) Dasiphora fruticosa subsp. floribunda

Transcript Overview
Unique NameKC825072.1-RPL3.m1
OrganismDasiphora fruticosa subsp. floribunda ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
RPL3KC825072.1-RPL3Dasiphora fruticosa subsp. floribundagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
RPL3RPL3Dasiphora fruticosa subsp. floribundagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KC825072.1-RPL3.m1-cds1KC825072.1-RPL3.m1-cds1Dasiphora fruticosa subsp. floribundaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
RPL3KC825072.1-RPL3.p1Dasiphora fruticosa subsp. floribundapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KC825072 region KC825072:1..1583+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productribosomal protein S3
The following sequences are available for this feature:

mRNA sequence

>KC825072.1-RPL3.m1 ID=KC825072.1-RPL3.m1|Name=RPL3|organism=Dasiphora fruticosa subsp. floribunda|type=mRNA|length=1583bp
back to top

protein sequence of RPL3

>KC825072.1-RPL3.p1 ID=KC825072.1-RPL3.p1|Name=RPL3|organism=Dasiphora fruticosa subsp. floribunda|type=polypeptide|length=527bp
back to top

mRNA from alignment at KC825072:1..1583+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KC825072.1-RPL3.m1 ID=KC825072.1-RPL3.m1|Name=RPL3|organism=Dasiphora fruticosa subsp. floribunda|type=mRNA|length=1583bp|location=Sequence derived from alignment at KC825072:1..1583+ (Dasiphora fruticosa subsp. floribunda)
tggtaaatcantgtatcaagatgtcaatctgagatcttatttcggttcga tacgtccacctacgagactgacctttggctttcgtctcggtacgtgtatt attctacattttccaaaaagagcattcattcatttctttcttccccgtcg accacgacgactgaaacgacgcgaaaaatcnagacccggaaaggagtggt gggcttttgggaaagtcgggccgatcaggtgtcttcattcaagcgacgat acagaagaagaacgaaacgaagtgagaggccgggnggcagngaaaagagt cgagtcgatcaggctcgacgaccgggagaagcaaaacgaaattcggattt ggccgaaaaagaagcaacgctatggataccatgaccgatcaccatcgata aagaagaatctttctaaatcacttcgggtcagcngggccntcaagcatcc nnnnnnnnnnnnnnnnnnnnnnnnnnnagcgttcctgatagaaaatgacg actccttcagaaaaacnaagttattnaagttntttttnccannnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnngaattattcagtcatgcaatacttattgaatacaaagaaccaaatta atttagaccccgtcgtagttttcaatcatttcgtggcaccgagcgtgtct gaaccatctacgatggggggagcgaatgcacagggaagaagcttagataa gagaatacgttctcgcatcgctttttttgtagaaagctcgaccagcgaga aaaagtntttgnccgaagccaaaaagaggttgacccacttcannnnnnna gcgaatgatcttcgcttcgcgggaacaacaaaaaccaccatctcgctctt tccttttttcggtgctacctttttctttccaagggatggggttgggatgt ataataaccttttttttgaagatgcccgggaacaactcctaggtcnnnnn nnnnnnnnnnnnnnnnnnnncatgggtaaggatanngtaatngaattgat agagaaattcatagacctaggtaggataggagaattgataaagggaatag agatgatgatagagatcatactgagaaacagnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatag aacaaacactaatatcttaattgagtcggtcaagataaaatctgtttatc aaagtgcttctccgattgctcaagacatctcttttcaactgagaaacaaa acaagatcatttcgttccatttttagtaaaanngtgaaggatattnnnnn nnnaatgaaaannnnnnnnnnnnngatccgtatatgttgttcaggtcgat taaaaggcgcagaaatagctagaactgaatgcggaaagtatggaaaaaca tctcgtaatgtatttaaccagaaaatagattatgctcctgcggaagtatc tactcgttatggaatcttaggtgtcaaagtgtggatttcatatagtaaaa aaaagggacgtgctatatccgaaacgtacgaaa
back to top

Coding sequence (CDS) from alignment at KC825072:1..1583+

>KC825072.1-RPL3.m1 ID=KC825072.1-RPL3.m1|Name=RPL3|organism=Dasiphora fruticosa subsp. floribunda|type=CDS|length=1583bp|location=Sequence derived from alignment at KC825072:1..1583+ (Dasiphora fruticosa subsp. floribunda)
back to top