F3H, KJ524274.1-F3H.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameKJ524274.1-F3H.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
F3HF3HPrunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KJ524274.1-F3H.m1-cds1KJ524274.1-F3H.m1-cds1Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
F3HKJ524274.1-F3H.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KJ524274 region KJ524274:1..1530+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productflavonoid 3' hydroxylase
Genbank noteflavonoid pathway enzyme; alternatively spliced
The following sequences are available for this feature:

mRNA sequence

>KJ524274.1-F3H.m1 ID=KJ524274.1-F3H.m1|Name=F3H|organism=Prunus persica|type=mRNA|length=1530bp
back to top

protein sequence of F3H

>KJ524274.1-F3H.p1 ID=KJ524274.1-F3H.p1|Name=F3H|organism=Prunus persica|type=polypeptide|length=509bp
back to top

mRNA from alignment at KJ524274:1..1530+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ524274.1-F3H.m1 ID=KJ524274.1-F3H.m1|Name=F3H|organism=Prunus persica|type=mRNA|length=1530bp|location=Sequence derived from alignment at KJ524274:1..1530+ (Prunus persica)
atgggggaacataaaatgtttattctcatattcatcaccgtcgtcttcgc cgccctcttgtaccgtcttctgttctccggcaaccgccactccctccctc tcccccccggcccaaagccgtggcctattgttgggaatttgcctcatttg ggccccgtcccccaccactccctcgccgccttggcccgccagtatgggcc tctcatgcacctccgcctcggcttcgttgacgttgtcgtcgccgcctccg cctcagtggcgtcccagttcctgaagacccacgacaccaacttctcaagc cggccgcccaactctggcgccaagcatctcgcttataactaccacgattt ggtgtttgcaccgtacggtccgcgctggcggatgttgcggaagatcagct cagtccatttgttctccggcaaggctttggatgatcttcgacatgttcgc caggaggaggtagctgtgctggctcatggcttagcaggtgccgggtcaaa gccagtgaacttggctcagcttctaaatgtatgcacggtcaacgccctag ggcgggtgatggtggggaagaggttgtttggtgacggcagcggcagcggc gacgagaaggcggacgagttcaaggagatggttgtggagatgatggtgtt ggcaggagtgttcaacataggtgactttatccccgccctcgagtggctgg acttgcagggcgtggcggcgaagatgaagaagctgcacaagaggtttgat gccttcttgaccgccattgttgaagaacacaagaagagcagcggcggaaa gcatggggacatgttgactactttactctcgctcaaagaggatgctgacg gtgagggggccaagctgacagacaccgagattaaagctttgcttttgaat atgttcacagcaggtactgacacgtcatcaagcacagtggaatgggctat agcagaactccttcgccaccccaagattctggcccaagtccaacaagaac ttgaccaagttgtgggccgagaccagcttgtaactgaactggacctaccc aacttgacctacctccaggccgtgatcaaggaaaccttccggctccaccc gtccacccctctctcgttgcctcgcatggcatctgaaagttgcgaaatta acagcttccacatcccaaagggcgccactctcttagtcaatgtatgggcc atatcacgtgacccagagcaatggaaggagccacttgagttccgacccga aaggttcctaccgggcggggagaagcctcatgtggatgttagagggaatg attttgaagtgatcccatttggtgctgggcgcagaatgtgtgcggggatg agcctgggcttgcgtatggtccatctaatggctgcaaccctggtccatgc atttgactggaccttggctgatgggctaaccccagagaaattgaacatgg acgaagcatatgggctcactttacaacgagcggcacctctaatggtgcac ccgcgcacaaggctagcccctcatgcatga
back to top

Coding sequence (CDS) from alignment at KJ524274:1..1530+

>KJ524274.1-F3H.m1 ID=KJ524274.1-F3H.m1|Name=F3H|organism=Prunus persica|type=CDS|length=1530bp|location=Sequence derived from alignment at KJ524274:1..1530+ (Prunus persica)
back to top