CYP79D16, GU573413.1-CYP79D16.m1 (mRNA) Prunus dulcis

Transcript Overview
Unique NameGU573413.1-CYP79D16.m1
OrganismPrunus dulcis (Almond)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CYP79D16CYP79D16Prunus dulcisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
GU573413.1-CYP79D16.m1-cds1GU573413.1-CYP79D16.m1-cds1Prunus dulcisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CYP79D16GU573413.1-CYP79D16.p1Prunus dulcispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
GU573413 region GU573413:138..1742+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>GU573413.1-CYP79D16.m1 ID=GU573413.1-CYP79D16.m1|Name=CYP79D16|organism=Prunus dulcis|type=mRNA|length=1605bp
back to top

protein sequence of CYP79D16

>GU573413.1-CYP79D16.p1 ID=GU573413.1-CYP79D16.p1|Name=CYP79D16|organism=Prunus dulcis|type=polypeptide|length=534bp
back to top

mRNA from alignment at GU573413:138..1742+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU573413.1-CYP79D16.m1 ID=GU573413.1-CYP79D16.m1|Name=CYP79D16|organism=Prunus dulcis|type=mRNA|length=1605bp|location=Sequence derived from alignment at GU573413:138..1742+ (Prunus dulcis)
atggaagccaatgttggcttcctcacattgtgcttggccatcactttggt gcgtttcttaatgaagcgttattggcaccaaagcaagattaacgacaaca acaacaaagctatcaagcaacattacccacttcctcccactcccaagggc ctaaggccttggcctattgtgggcaacctccccgagatgctcatgaacaa gcccacattccggtggatacacaagctcatggaggaaagcaacactgaaa tcgcttgcattcgtcttgcaaacgttcatgtcatccccgtctcctgcccc attctcagccgcgaaatcttgaagaaacaagatgcaacttttgccacgag gcctctcagcatctccaccttcctcatcaccaaagggtacataaccactg ttatggtgcccttcggggagcaatggaagaaaatgaggaaggtcatcaca tccgagttgctctctcccatgagacataagtggctcacggacaagaggat tgaggaggccgaccaccttgttcgatacgtgttcaaccagtgcaacaatg aggagggcagaggcattgtggatttgagacttgctacacaacattattgt gcaaatgtgattaagagaatgattttcaaccagaggtactttacggagga gatgaaggacggaggtcctagtgttgaggaacaaaactatgtaaatgcag tgttcgatatgctcaggtacatctatgcattttctgcgtccgattacatc tcatgcttgagaggcctcgatttggacggccatgagaagatcataaagga ttgcattaagcttacaagaaaacgccaagaccccgtcattgaagagagga ttcgtgaacatcagaaacttggaggaaacaaggtcccagtagacttgctt gacattcttatctcactcaaagacgccagtggtcaacccttgctctcacc agacgagatcaaaggccaagtaaatgagatgataatggcagcagtggaca acccctcaaacgcagctgaatgggcaattgcagagatgataaaccaaccc cacctgttcgagaaagcaagacaagaacttgacgctgtggttggcaaaga aagacaagtgcaagagtcagatctgtcgcagctcaacttcgtcaaggcct gcgctcgagaagccttccgcctccacccggtggcgccattcaacgtcccc cacgtgtcgatggccgacacgaccgtgggcgattacttcatccccaaggg cagccacgtgatgctgagccgaatcgggctcggccgcaaccctaaaattt gggacgagcccctcaagtacaagcccgagcgccacctcaaggacgacggg tcaggtgttgtactcactgagtcagagctccgattcatatcgttcagcac cggcatgcgaggctgcgtcgcgagtacactcggcacgagcatgactgtga tgctgtttgctaggcttcttcatgggtttacttgggaagcgccccccaat gagtcgagaatcgacctcaccgaggcaggtggcgagctcctactcgcgaa gccactgcttgcactcgcgaagccacgcctgccagctcacgtgtaccaga cataa
back to top

Coding sequence (CDS) from alignment at GU573413:138..1742+

>GU573413.1-CYP79D16.m1 ID=GU573413.1-CYP79D16.m1|Name=CYP79D16|organism=Prunus dulcis|type=CDS|length=1605bp|location=Sequence derived from alignment at GU573413:138..1742+ (Prunus dulcis)
back to top