SNP_TC_28804875, SNP_TC_28804875 (genetic_marker) Malus x domestica

Marker Overview
NameSNP_TC_28804875
Genbank IDN/A
TypeSNP_TSP
SpeciesMalus x domestica
Primer 1SNP_TC_28804875.S8_875_For: ATCAGAAGCAGGCAAGTGGT
Primer 2SNP_TC_28804875.S8_875_Rev: AGCTCCCCTCATTCCTTCAT
Primer 3SNP_TC_28804875.S8_875_TSP: GGAGAAATCATCGAAACG
Publication[view all]
CommentTSP (Temperature Switch PCR) primers
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
S8_875_ForSNP_TC_28804875.S8_875_ForMalus x domesticaprimer
S8_875_RevSNP_TC_28804875.S8_875_RevMalus x domesticaprimer
S8_875_TSPSNP_TC_28804875.S8_875_TSPMalus x domesticaprimer