SNP_AC_30391205, SNP_AC_30391205 (genetic_marker) Malus x domestica

Marker Overview
NameSNP_AC_30391205
Genbank IDN/A
TypeSNP_TSP
SpeciesMalus x domestica
Primer 1SNP_AC_30391205.S8_205_For: CGGACCTGTCTTGGTATGGT
Primer 2SNP_AC_30391205.S8_205_Rev: TGGGCAAATTAGGGATTGAC
Primer 3SNP_AC_30391205.S8_205_TSP: GCTCACCCCCATGAAC
Publication[view all]
CommentTSP (Temperature Switch PCR) primers
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
S8_205_ForSNP_AC_30391205.S8_205_ForMalus x domesticaprimer
S8_205_RevSNP_AC_30391205.S8_205_RevMalus x domesticaprimer
S8_205_TSPSNP_AC_30391205.S8_205_TSPMalus x domesticaprimer