SNP_GA_31139398, SNP_GA_31139398 (genetic_marker) Malus x domestica

Marker Overview
NameSNP_GA_31139398
Genbank IDN/A
TypeSNP_TSP
SpeciesMalus x domestica
Primer 1SNP_GA_31139398.S8_398_For: GCAGAGCCTTCTGCAAAGAT
Primer 2SNP_GA_31139398.S8_398_Rev: CAAATTGCAGTGCTGTTGGT
Primer 3SNP_GA_31139398.S8_398_TSP: GGACTGGTGAAGGTGGT
Publication[view all]
CommentTSP (Temperature Switch PCR) primers
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
S8_398_ForSNP_GA_31139398.S8_398_ForMalus x domesticaprimer
S8_398_RevSNP_GA_31139398.S8_398_RevMalus x domesticaprimer
S8_398_TSPSNP_GA_31139398.S8_398_TSPMalus x domesticaprimer