SFB17, SFB17 (gene) Prunus tenella

Gene Overview
Name SFB17
Gene Symbol SFB17
Type gene
Organism Prunus tenella
Synonym SFB17 protein
Description NA
Comment S-haplotype-specific F-box protein; PtSFB17 protein
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB17KU167067.1-SFB17.m1Prunus tenellamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus tenellagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KU167067.1-SFB17.m1 N/A KU167067.1

Sequence(s):
>KU167067.1-SFB17.m11131
atgagatttacactacataagaaagaaatcttaatcgacatcctagtaagacttcctgcaaaatccctcgttcgatttct
gtgtacttgcaagtcatggagtgatttgattggaagcttgagttttgtgagcacacaccttcataggaatgtcacaaagc
atgaccatgtctatctactttgcctccactactcaatttttgaacttcaggctgatcctgatgacccacatgttaaacaa
gaatttcaatggtctcttgtttccaatcaaacatttgaggagtgctccaagttaagccatcccttagggatcacagatca
ttatgtgatgtatggctcaagcaatggtttaatttgcatttcggatgagatactgaattttgatagtcctgtatacatat
ggaacccatcggttaggaaacttagaaccactccaatcagcaccaacattaacattaattttagccatgttgctctccaa
ttcgggttccaccccggggttaatgactgcaaggctgtaaggatgatgcgtaccaacaaaaataccttagcggttgaggt
ttatagtcttaaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcttaacg
gtacattttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtcttttgattcaggcagt
gaagaattcgaagaattcgtagcaccagatgccatttgcagttcatgggggttatgtattgacgtttacaatgaacaaat
ttgcttgcttcttaagttttattcttgtgaggtggaaggcatgaagaaaatcgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtcctcttactttttctttggattacaattatcgtacaatcgggattagtatagataataaactctta
atgctaagaacagattacaataggggcatatcaaatctgcatttgtatgattacaatttcaagcaagttcttgatacagg
aattaagttggccgtcatgaaatatggcgaaatggaattcttgtattcaactgcttacatagaaagtttggttttactca
ataattattaa
back to top