VHA-C4, VHA-C4 (gene) Pyrus betulifolia

Gene Overview
Name VHA-C4
Gene Symbol VHA-C4
Type gene
Organism Pyrus betulifolia
Synonym vacuolar H+-pumping ATPase C4
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
VHA-C4KT987225.1-VHA-C4.m1Pyrus betulifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
vacuolar H+-pumping ATPaseVHAPyrus betulifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KT987225.1-VHA-C4.m1 N/A KT987225.1

Sequence(s):
>KT987225.1-VHA-C4.m1501
atgtcttcttcaaccttcagcggcgatgaaacggcaccgttcttcgggttccttggcgccgccgcggccctcgttttctc
ctgcatgggagctgcgtacgggacggcgaagagcggagtaggagtggcctcgatgggtgtgatgaggccggagctggtga
tgaagtcgatcgtgccggtggttatggcgggagtgttgggtatttacggacttatcatcgccgtcatcatcagtaccggt
atcaaccccaaggccaaaccctattaccttttcgatggctatgctcatctttcctctggtctagcttgtggccttgctgg
tctctctgccggtatggctatcggcattgtcggtgatgccggtgttagagccaatgcacaacagccaaagcttttcgttg
ggatgatcctcattctcattttcgccgaagcgcttgctctgtacggtctgattgttggcatcattctctcttcccgatcg
gggcagtcaagagctgactag
back to top