ANR, KR732618.1-ANR (gene) Rubus hybrid cultivar

Gene Overview
NameANR
Unique NameKR732618.1-ANR
Typegene
OrganismRubus hybrid cultivar ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRANRRubus hybrid cultivargene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
ANRKR732618.1-ANR.m1Rubus hybrid cultivarmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreKR732618.1
Alignments
Feature NameTypeLocationAnalysis
KR732618 region KR732618:263..2000+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>KR732618.1-ANR ID=KR732618.1-ANR|Name=ANR|organism=Rubus hybrid cultivar|type=gene|length=1738bp
atggccacccgccaacccatcatctcaaacaagactgcttgtgtgatcgg
tggcaccggcttcgtcgcgtctctgctgatcaagctcttgctagagaagg
gctatgccgtcaaaaccacagctggagaccctggtcagaacttcttcatt
tatctgacaaactcaacctataatatttggcttaccctatttttgcttat
gttttctttaatatttctcatcgatcatatgcttttggaacaccaacaaa
atatagtaatgcatgttgtaacagaaaaacaattaacaacaaaagacact
aattgacatacacaaatggtgtgatattgaggacttagaattaggttttt
aaccccgggtcaatgtaaacagtctctgttaaattttatttcccagagta
ataaatttctgattttagtgtgtatattatggtggtgtgaagtctgtctt
tcattttgtacatttgggcacagataatcagaagaagatctcccacctca
tagcactacaagctttgggagacctaacgatttttcgaggtgatttaacc
gatgaaggtagcttcgatgctgcgattgcgggatctgacattgttttcca
tgttgccacacctgtccactttggctcgcaggacccggaggtacataata
ttcgtagaaattgcttagctaaaaattgcatttggtcatatagttttgct
gcagcttaagcacaatgtactttcttccctttccaatatccagaatgaca
tgatcaagccgggagtccaaggagtactaaacgttatgaaatcatgtgtc
aaagccaagacagtcaaacgtgtcgttttgacatcatcagcagctgcagt
gactgtcaatactctcactggaacaggcttggtcgtggacgaaaatgatt
ggtctgatgttgagttcttgaccactgccaagccacctacttgggtaaat
cacataattgtttttgtctataagatgaaatgttttctgaaataaatgaa
ctaggtgatcaaactaaaacttttcctcaaatgttcaggggtatcctgtt
tccaaggtactagctgagaagacagcttggaaattcgccgaagaaaacag
cattgatctcatcactgtgatcccttctctgatggctggtgctagtctca
ctccagatatccccagcagtattggcctcgccacgtctttaattacaggt
aagaaatcagaaggtggaatatgttacatgtccatattagcaccgcggtg
ttctaatggtactcttttacaggaaatgaattcctcataaatggcttgaa
aggcatgcaaatgctatcaggttctatatccattacacatgtggaagatg
tctgccgagctcatatatttttggcagagaaagaatctgcttctggtcgg
tacatatgctgcgctgcaaatagcggtgttcctgagctagcaaagttcct
gagcaaaagatatcccaactaccaagtccccactgagtaagccctccctt
taacccaatgactcagcttgcagaaaaacttgaactgcacctcatttagt
tattgctacattacagatagttactctacttttgcaattgcaggtttgga
gattttccgaccaaggccaagaccataatctcttcggaaaagcttaagaa
ggaggggttcactttcaagtacgagattgaagacatatatgaccaagctg
tggagtacttgaaggctaagggggtgctgcagaactag
back to top

gene from alignment at KR732618:263..2000+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KR732618.1-ANR ID=KR732618.1-ANR|Name=ANR|organism=Rubus hybrid cultivar|type=gene|length=1738bp|location=Sequence derived from alignment at KR732618:263..2000+ (Rubus hybrid cultivar)
atggccacccgccaacccatcatctcaaacaagactgcttgtgtgatcgg tggcaccggcttcgtcgcgtctctgctgatcaagctcttgctagagaagg gctatgccgtcaaaaccacagctggagaccctggtcagaacttcttcatt tatctgacaaactcaacctataatatttggcttaccctatttttgcttat gttttctttaatatttctcatcgatcatatgcttttggaacaccaacaaa atatagtaatgcatgttgtaacagaaaaacaattaacaacaaaagacact aattgacatacacaaatggtgtgatattgaggacttagaattaggttttt aaccccgggtcaatgtaaacagtctctgttaaattttatttcccagagta ataaatttctgattttagtgtgtatattatggtggtgtgaagtctgtctt tcattttgtacatttgggcacagataatcagaagaagatctcccacctca tagcactacaagctttgggagacctaacgatttttcgaggtgatttaacc gatgaaggtagcttcgatgctgcgattgcgggatctgacattgttttcca tgttgccacacctgtccactttggctcgcaggacccggaggtacataata ttcgtagaaattgcttagctaaaaattgcatttggtcatatagttttgct gcagcttaagcacaatgtactttcttccctttccaatatccagaatgaca tgatcaagccgggagtccaaggagtactaaacgttatgaaatcatgtgtc aaagccaagacagtcaaacgtgtcgttttgacatcatcagcagctgcagt gactgtcaatactctcactggaacaggcttggtcgtggacgaaaatgatt ggtctgatgttgagttcttgaccactgccaagccacctacttgggtaaat cacataattgtttttgtctataagatgaaatgttttctgaaataaatgaa ctaggtgatcaaactaaaacttttcctcaaatgttcaggggtatcctgtt tccaaggtactagctgagaagacagcttggaaattcgccgaagaaaacag cattgatctcatcactgtgatcccttctctgatggctggtgctagtctca ctccagatatccccagcagtattggcctcgccacgtctttaattacaggt aagaaatcagaaggtggaatatgttacatgtccatattagcaccgcggtg ttctaatggtactcttttacaggaaatgaattcctcataaatggcttgaa aggcatgcaaatgctatcaggttctatatccattacacatgtggaagatg tctgccgagctcatatatttttggcagagaaagaatctgcttctggtcgg tacatatgctgcgctgcaaatagcggtgttcctgagctagcaaagttcct gagcaaaagatatcccaactaccaagtccccactgagtaagccctccctt taacccaatgactcagcttgcagaaaaacttgaactgcacctcatttagt tattgctacattacagatagttactctacttttgcaattgcaggtttgga gattttccgaccaaggccaagaccataatctcttcggaaaagcttaagaa ggaggggttcactttcaagtacgagattgaagacatatatgaccaagctg tggagtacttgaaggctaagggggtgctgcagaactag
back to top