CBFA, KU587042.1-CBFA.m1 (mRNA) Prunus mume

Transcript Overview
Unique NameKU587042.1-CBFA.m1
OrganismPrunus mume ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CBFACBFAPrunus mumegene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KU587042.1-CBFA.m1-cds1KU587042.1-CBFA.m1-cds1Prunus mumeCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CBFAKU587042.1-CBFA.p1Prunus mumepolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KU587042 region KU587042:47..742+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductCBF/DREB1-like protein a
The following sequences are available for this feature:

mRNA sequence

>KU587042.1-CBFA.m1 ID=KU587042.1-CBFA.m1|Name=CBFA|organism=Prunus mume|type=mRNA|length=696bp
back to top

protein sequence of CBFA

>KU587042.1-CBFA.p1 ID=KU587042.1-CBFA.p1|Name=CBFA|organism=Prunus mume|type=polypeptide|length=231bp
back to top

mRNA from alignment at KU587042:47..742+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KU587042.1-CBFA.m1 ID=KU587042.1-CBFA.m1|Name=CBFA|organism=Prunus mume|type=mRNA|length=696bp|location=Sequence derived from alignment at KU587042:47..742+ (Prunus mume)
atggacatgttctccgctcagctttctaactcccccgaccagcccgagtc gagttctttctccgacgccagcttcaccaccctgccggcttcttcctccg acgaaaacgtcatattggcgtcgagccggccgaagaagcgcgctgggagg agggttttcaaggagacgaggcacccggtttacaggggggtgaggagaag gaacaacaacaagtgggtgtgtgagttgagagagccaaacaagaagaaat caaggatttggcttggaacgtatccgactgctgagatggctgctcgtgcc catgacgtggcggcattggcgttcagagggaagcttgcctgcataaactt tgctgactccgcatggcggctgcccttgccggcttccatggataccatgg atatccgaagggcagctgctgaggccgccgaagggttcaggccagcggag ttcggtggattatccagctgcagcagtgatgagaaggagaagatttttag cgtggatgtggaaaaaagcagcagcagcttgtgcttgttttatttggatg aggaggaaatgtttgatatgccaaggttgattgataacatggctcaaggg cttcttctttctccacctcaatgttcagctggctacttgaactgggatga catggaaactgaagctgatgccaaactatggagtttctctatctga
back to top

Coding sequence (CDS) from alignment at KU587042:47..742+

>KU587042.1-CBFA.m1 ID=KU587042.1-CBFA.m1|Name=CBFA|organism=Prunus mume|type=CDS|length=696bp|location=Sequence derived from alignment at KU587042:47..742+ (Prunus mume)
back to top