CBF1, KM245570.1-CBF1.m1 (mRNA) Prunus dulcis

Transcript Overview
Unique NameKM245570.1-CBF1.m1
OrganismPrunus dulcis (Almond)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CBF1CBF1Prunus dulcisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KM245570.1-CBF1.m1-cds1KM245570.1-CBF1.m1-cds1Prunus dulcisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CBF1KM245570.1-CBF1.p1Prunus dulcispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KM245570 region KM245570:1..729+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductC-repeat binding factor 1
Genbank noteAcCBF1
The following sequences are available for this feature:

mRNA sequence

>KM245570.1-CBF1.m1 ID=KM245570.1-CBF1.m1|Name=CBF1|organism=Prunus dulcis|type=mRNA|length=729bp
back to top

protein sequence of CBF1

>KM245570.1-CBF1.p1 ID=KM245570.1-CBF1.p1|Name=CBF1|organism=Prunus dulcis|type=polypeptide|length=242bp
back to top

mRNA from alignment at KM245570:1..729+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KM245570.1-CBF1.m1 ID=KM245570.1-CBF1.m1|Name=CBF1|organism=Prunus dulcis|type=mRNA|length=729bp|location=Sequence derived from alignment at KM245570:1..729+ (Prunus dulcis)
atgaacaggttcttctctcatttttctgactccgtcgaccagcccgagtc aagttcgttgtccgacaacacagtcacgactctaagggcttcttggtccg acgaggacgtcattttggcgtcgagccgaccaaagaagcgagctgggagg agggttttcaaggagaccaggcaccctgtttataggggcgtgaggaggag gaacaatgacaagtgggtgtgtgaaatgagagagcccaagaagacgaagt ccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcc catgacgtggcggcattggcgtttagagggaagcttgcctgcctcaactt ccctgactccgcttggaagctgcccttgccggcttccatggatgcaatgg atattcggagagcggccgccgaggcagctgaggggtttaggccggtggag tttggtggagtgtccagcagcagcagtgatgagaaggagagaatggtggt gcaggtggaagagaagaagaagaagaagaagaaggatagtgtgaatatgg aaaaaagtacaagcttgagcttgtcctattgggatgaggaagaagtgttt gacatgccaaggttgcttgatgacatggctcaaggccttcttctttctcc acctcaatgcttaggtggcgacatttgggatgacatgggaaccgatgctg atgtcaaattgtggagtttctccaattaa
back to top

Coding sequence (CDS) from alignment at KM245570:1..729+

>KM245570.1-CBF1.m1 ID=KM245570.1-CBF1.m1|Name=CBF1|organism=Prunus dulcis|type=CDS|length=729bp|location=Sequence derived from alignment at KM245570:1..729+ (Prunus dulcis)
back to top