ANR, KR732618.1-ANR.m1 (mRNA) Rubus hybrid cultivar

Transcript Overview
Unique NameKR732618.1-ANR.m1
OrganismRubus hybrid cultivar ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRKR732618.1-ANRRubus hybrid cultivargene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRANRRubus hybrid cultivargene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KR732618.1-ANR.m1-cds1KR732618.1-ANR.m1-cds1Rubus hybrid cultivarCDS
KR732618.1-ANR.m1-cds2KR732618.1-ANR.m1-cds2Rubus hybrid cultivarCDS
KR732618.1-ANR.m1-cds3KR732618.1-ANR.m1-cds3Rubus hybrid cultivarCDS
KR732618.1-ANR.m1-cds4KR732618.1-ANR.m1-cds4Rubus hybrid cultivarCDS
KR732618.1-ANR.m1-cds5KR732618.1-ANR.m1-cds5Rubus hybrid cultivarCDS
KR732618.1-ANR.m1-cds6KR732618.1-ANR.m1-cds6Rubus hybrid cultivarCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ANRKR732618.1-ANR.p1Rubus hybrid cultivarpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KR732618 region KR732618:263..2000+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productanthocyanidin reductase
The following sequences are available for this feature:

mRNA sequence

>KR732618.1-ANR.m1 ID=KR732618.1-ANR.m1|Name=ANR|organism=Rubus hybrid cultivar|type=mRNA|length=1020bp
back to top

protein sequence of ANR

>KR732618.1-ANR.p1 ID=KR732618.1-ANR.p1|Name=ANR|organism=Rubus hybrid cultivar|type=polypeptide|length=339bp
back to top

mRNA from alignment at KR732618:263..2000+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KR732618.1-ANR.m1 ID=KR732618.1-ANR.m1|Name=ANR|organism=Rubus hybrid cultivar|type=mRNA|length=1738bp|location=Sequence derived from alignment at KR732618:263..2000+ (Rubus hybrid cultivar)
atggccacccgccaacccatcatctcaaacaagactgcttgtgtgatcgg tggcaccggcttcgtcgcgtctctgctgatcaagctcttgctagagaagg gctatgccgtcaaaaccacagctggagaccctggtcagaacttcttcatt tatctgacaaactcaacctataatatttggcttaccctatttttgcttat gttttctttaatatttctcatcgatcatatgcttttggaacaccaacaaa atatagtaatgcatgttgtaacagaaaaacaattaacaacaaaagacact aattgacatacacaaatggtgtgatattgaggacttagaattaggttttt aaccccgggtcaatgtaaacagtctctgttaaattttatttcccagagta ataaatttctgattttagtgtgtatattatggtggtgtgaagtctgtctt tcattttgtacatttgggcacagataatcagaagaagatctcccacctca tagcactacaagctttgggagacctaacgatttttcgaggtgatttaacc gatgaaggtagcttcgatgctgcgattgcgggatctgacattgttttcca tgttgccacacctgtccactttggctcgcaggacccggaggtacataata ttcgtagaaattgcttagctaaaaattgcatttggtcatatagttttgct gcagcttaagcacaatgtactttcttccctttccaatatccagaatgaca tgatcaagccgggagtccaaggagtactaaacgttatgaaatcatgtgtc aaagccaagacagtcaaacgtgtcgttttgacatcatcagcagctgcagt gactgtcaatactctcactggaacaggcttggtcgtggacgaaaatgatt ggtctgatgttgagttcttgaccactgccaagccacctacttgggtaaat cacataattgtttttgtctataagatgaaatgttttctgaaataaatgaa ctaggtgatcaaactaaaacttttcctcaaatgttcaggggtatcctgtt tccaaggtactagctgagaagacagcttggaaattcgccgaagaaaacag cattgatctcatcactgtgatcccttctctgatggctggtgctagtctca ctccagatatccccagcagtattggcctcgccacgtctttaattacaggt aagaaatcagaaggtggaatatgttacatgtccatattagcaccgcggtg ttctaatggtactcttttacaggaaatgaattcctcataaatggcttgaa aggcatgcaaatgctatcaggttctatatccattacacatgtggaagatg tctgccgagctcatatatttttggcagagaaagaatctgcttctggtcgg tacatatgctgcgctgcaaatagcggtgttcctgagctagcaaagttcct gagcaaaagatatcccaactaccaagtccccactgagtaagccctccctt taacccaatgactcagcttgcagaaaaacttgaactgcacctcatttagt tattgctacattacagatagttactctacttttgcaattgcaggtttgga gattttccgaccaaggccaagaccataatctcttcggaaaagcttaagaa ggaggggttcactttcaagtacgagattgaagacatatatgaccaagctg tggagtacttgaaggctaagggggtgctgcagaactag
back to top

Coding sequence (CDS) from alignment at KR732618:263..2000+

>KR732618.1-ANR.m1 ID=KR732618.1-ANR.m1|Name=ANR|organism=Rubus hybrid cultivar|type=CDS|length=1020bp|location=Sequence derived from alignment at KR732618:263..2000+ (Rubus hybrid cultivar)
back to top