CPP21245, CPP21245 (genetic_marker) Prunus persica

Marker Overview
NameCPP21245
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
Primer 1CPP21245.forward primer: GGGAGATACGGGATTTGGAT
Primer 2CPP21245.reverse primer: AGCCTTTTTGGACCTCCCTA
Publication[view all]
ContactPere Arus
Contact
NameDetails
Pere Arus
First name:Pere
Last name:Arus
Title:Researcher
Institution:IRTA
Address:IRTA, Centre de Recerca en Agrigeno`mica CSIC-IRTA-UAB-UB; Campus UAB, Bellaterra (Cerdanyola del Valle`s), 08193 Barcelona, Spain
Country:Spain
Email:pere.arus@irta.cat
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerCPP21245.forward primerPrunus persicaprimer
reverse primerCPP21245.reverse primerPrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CPP21245CPP21245Prunus persicamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus-TE-BC1-T1EG6_T1EN/A1.1CPP21245View
2Prunus-TE-BC1-EG6_EN/A1.8CPP21245View