CPP21413, CPP21413 (genetic_marker) Prunus persica

Marker Overview
Genbank IDN/A
SpeciesPrunus persica
Primer 1CPP21413.forward primer: ACGTCCTTTGGGAAATCCAT
Primer 2CPP21413.reverse primer: AGCACAACACTCTCGAAATCC
Publication[view all]
ContactPere Arus
Pere Arus
First name:Pere
Last name:Arus
Address:IRTA, Centre de Recerca en Agrigeno`mica CSIC-IRTA-UAB-UB; Campus UAB, Bellaterra (Cerdanyola del Valle`s), 08193 Barcelona, Spain

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerCPP21413.forward primerPrunus persicaprimer
reverse primerCPP21413.reverse primerPrunus persicaprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CPP21413CPP21413Prunus persicamarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer