SFB17, SFB17 (gene) Prunus armeniaca

Gene Overview
Name SFB17
Gene Symbol SFB17
Type gene
Organism Prunus armeniaca
Synonym S-locus F-box protein 17
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB17EU652885.1-SFB17Prunus armeniacagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB17EU652885.1-SFB17.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus armeniacagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU652885.1-SFB17 N/A EU652885.1
mRNA parsed from NCBI nr database EU652885.1-SFB17.m1 N/A EU652885.1

Sequence(s):
>EU652885.1-SFB171131
atggcatcgacactacgtaagaaagaaatcttagtcgacatcctactaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagttatggagtaatttgatttgcagcttgagtttcgctagcacacaccttcacaggaatgtcacaggac
atgcccatgcctatctactttgcctccaccagccaaattttgaatgtcaaagggacgatgatgacccatattttaaagaa
gaactccaatggtcattgttttccaatgtaacatttgagcagtgctgcacgttaagccatccattagggagcacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaattttgatagtcctatacacatat
ggaacccatcggttaggaaacttaggacccctccaatgagcaccaacactaacattaaatttagctatgttgctcttcaa
ttcgggtttcactccggagttaatgactacaaggttgttaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtcttggtacagactgctggaagctgattcaagcaattcctccttggttaaaatgcacttggaagcatcacaagg
gtacatttttgaatggagtagcataccacatcattgagaaaggtcctatattcagcattatgtccttcgattcaggcagt
gaagacttcgaagaattcatagcaccagatgccatttgcaattcatggaagttatgcatccaagtttacaaggaacagat
ttgcttgctttttggattttatggttgtgaggaggagggcatggaaaacattgacatatgggttctgcaagaaaaacggt
ggaaacaattgtatccttttatttatgatcctttggattgctgttatcagataatcgggactagtataaacaatgaactc
ttaatggcaagaagagatttcgatgacggggtagtaggtctgcaattgggtaattacgaatccaagcaagttcttgacac
agggattaagttggccatcatgagatatggggaaatcgaattcttgtttgcaattacttacatagaaagtttagttttac
tcaataactaa
back to top
>EU652885.1-SFB17.m11131
atggcatcgacactacgtaagaaagaaatcttagtcgacatcctactaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagttatggagtaatttgatttgcagcttgagtttcgctagcacacaccttcacaggaatgtcacaggac
atgcccatgcctatctactttgcctccaccagccaaattttgaatgtcaaagggacgatgatgacccatattttaaagaa
gaactccaatggtcattgttttccaatgtaacatttgagcagtgctgcacgttaagccatccattagggagcacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaattttgatagtcctatacacatat
ggaacccatcggttaggaaacttaggacccctccaatgagcaccaacactaacattaaatttagctatgttgctcttcaa
ttcgggtttcactccggagttaatgactacaaggttgttaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtcttggtacagactgctggaagctgattcaagcaattcctccttggttaaaatgcacttggaagcatcacaagg
gtacatttttgaatggagtagcataccacatcattgagaaaggtcctatattcagcattatgtccttcgattcaggcagt
gaagacttcgaagaattcatagcaccagatgccatttgcaattcatggaagttatgcatccaagtttacaaggaacagat
ttgcttgctttttggattttatggttgtgaggaggagggcatggaaaacattgacatatgggttctgcaagaaaaacggt
ggaaacaattgtatccttttatttatgatcctttggattgctgttatcagataatcgggactagtataaacaatgaactc
ttaatggcaagaagagatttcgatgacggggtagtaggtctgcaattgggtaattacgaatccaagcaagttcttgacac
agggattaagttggccatcatgagatatggggaaatcgaattcttgtttgcaattacttacatagaaagtttagttttac
tcaataactaa
back to top